Transcript Name :
Phyra_80278
Orientation:
(+)
Number of Exons:
4
Description :
phox domain-containing protein, partial
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
4336
Sequence
        1784 bases(100 bases per row)
ATGGGCACTGCGCTCCGTCTACGAACCCATTTCTGAAAGATTTCTGGAAAAACCAACCGACACTTGCTCAATCTCTCTGCCACTATTCAGCCTGCCCCGA
GACTGCGCATTGATCACGTCGAGCTGCTCACGCCGCACGCCGCCACACCACAGGTGCTCGCCTCCATCTTTGTGCCTTTCTTCGCGTGCCAGTTTCGAGT
GCCACATCGCCGATCGTTCGCCGCTCTCCCGTCCAGTCTACGCATTCGGTTGGCCGCCAGCTGAAAGCAGCGGCAACAGCTCTCCTCTCTTCCTCTCGCG
CACAGTTCCGCCTGCCGCGCCGCCGAGAAGAAGAGCGAGCGAAACGCAGCGACTGAGCAGCACCATTGGCCAGGCCTTCTTCTGCCTGCAGACGCGGCCG
CAGCCGGTGGCCCCGTTCGCGAGCGGGACAGTGCTGAGCTTCCACGCGCCTGGCGAACCCGACGCCGTGCGCGAACGCCTCGCGCGTCTACTGAGCCTCT
CTGCAGCCATGATGGCCGAACCCGACGTGCTGACCAAAGCCGATAGCGACGGCGATGCCAGCGAGACCGCCGATGCCTTCCGCCCCGCGGACGACGACCT
GCAGCAACTCACGGTGCAGTCGCTCCCCTACGTCAAGTGCCGCGAGAGCGTGAGCGCCGTGTTCAGCTTCGACTCGGCGGCGCGTCGCCGTGTTTCGCTG
GCGTCCAACGCGACGTCCGACACGGCCAATTCGTCGCCTGAACACGCCGACAAGTTCCCCACGTCGCTCTCGTACTCAGTCCCGTCCACCGCGATAGTGA
CCAACACGCCGCGCGGCCGGCCCGCCGTGGACGTGATCGCTACGTACATGAACACGTGTGACCAGCGCACGGTGAAATCGGAGCTCATGCGTGCCCACGC
GCACTTTGCCTCACCTCGAGGTACGGACATGCTCTTTTGCTCTTGCCTGCTGTGGTTGAAGTTGAAGGCCATTGCGGCGCAGACGAAAGAACTGACTGTA
GTGATTTGGTGTTTTGTCGTTGACACGTTTGTGTTGCGTTGTTTGTTGCTGCTGTTGGTGAAGGTGGCCCGCCGTCGCGCATCCGTTCGTCTTCCATTAT
GAGCAAGGAGGGCAGTGCTGAATGGGGCTGGTTCGCCGACATCGACTCGAGTAGCGAAAGCTGGGGTGGCGATGGTTCCATCCACTCGCTGCGGCGCCGA
CTAAGCGCTGACTTGGGACTCATCGACGTGGGCAACGTCCACGTCCTGGGTGATGAACAGACCAACACACGCATCACAGCAGCGCACAAGACGTTTACAA
TAGTCACGGAAGGCAACAGCAAGGTGGTCTCAGCTACAGTGTCCATTCCCAAGTTCCGCATTGTGCAGTCACGCTCCGGCGCCGACCGCCACGCGCAGTA
TTTAATCACCCTCATGCTCGGCAAGGAGCTGTACGCAGACTGGCGTCGGTACTCGGAGTTTGGTGAACTAGTGAAGACGCTGGATGAAAAGCGCTACACG
CGGACACAAGATGCCTGGGCAGGAATCGAGACGCGCTGGTTCAATCGGCTAGAACCGTCGTATTTGCACCAGAAATGCATCACACTCGAGAACTTCATGC
GCGAGCTCATGTACGAGTCGAACGAGCCGAATGTGCTGATCAACTTCCTCGGCGGCTATCTGGGTAAGGTTAACGCGCGGCCTACGGACCCCGTGGCATA
TCGCCCAGCAGCTCAGCTCCCGAAGGAGCTTCGTCCACCACAGCCGCAACACGAGCGAGAGCTGTTCGAGAAGATGTGGGCTGA