Transcript Name :
Phyra_78233
Orientation:
(+)
Number of Exons:
2
Description :
Major Facilitator Superfamily (MFS) putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain11.292PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.5211.2160.002
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1543 bases(100 bases per row)
ATGAGAGACGTGTCTTGGGGCCTGACGGAGCACAATGTACAGCTCGTGTTCCTCTTCACGGTGACCTACTGGTCTGCCAGCAGGTACGCCCCAAGTGAAC
TGACACCCTTTCCTGCATCAATGCTGACCTTGTCGTAGTATTATTTCGCAGCAGGTGCTATCGGGCTACGTGTACGTGTTGACGGCTTCCAACGTCCCTG
TGGGCTTCGTCAAGGGCATTCAGGGTCTAGCCCAGCTACTGTGCGCATTCCCTGCTGGTTATGCAGCGGACAGTACACGTCGAGACCGGATCCTCGCGCT
TTCAGGCGTTCTCGGCGTCGTGGCTTCGGTGCTGACAGCGTTGGCTTTCGAGTTAGGCGACATGGTCCTCATTTACGTGGCTTTCGGACTATGGGGGGCC
TTCACTGCCTTCCAGAGCTCGGCCATGGAGGCTCTGTTCGCTGACTCGGTGCCGGTAGGGCAAAGATCAGCGCCGTTCACGCTGAAGTACGTCATGCGCA
ACGTCGCGCTTGTGCTCGGGCCTTTGAGTGCGATGCTGTTGCTATGGAAGCACGGTGATGCGTGGACGCTTGCAGCACTGCGACCCGTTCTGCTTTTCGG
AGCGTTCATCGCGGCAGTGTCCATGGTCGTGCTGTTTCAGTTCAACGACGACCTAGCATTTGAGAACCGGCAGTACGTGTTCGCTATCGAGCGCGAGCTG
AGCTCCATCGAGCGCAACTTCACATCCGAGTACAGCGAGAGAGAAAGCTCCGCCTCCGAACGAGGAGGGAGCTTTTCTCGTGTGCACATGCCCTCGACAA
GCGAGTTCTCTCAACTTCTCCGGTCTTCAAGGGTTCCTTCAGTAACCAGCGGCTACTACTTGGCTGCTCCAGTGCGGAGTGACGATGGCGAGGATGTCCC
GGTACGCCCCGTCATGGCGTGTTGCGGGATGCTCGACACTGCGCACGTCCCGTACCTGCTGTTTGTGTCGGACTTCCTTGTGAGCAACGGCACCGGACTT
GTCACGGCGTTCTTCCCGCTCTTCTTTCTCAACGAGTACGCGCTGTCTCCGGTTCGAGTGCAGACCCTCTTCGCACTGCAGCCACTGGTGATTGCACTGC
TGTCGCTCCTAGCGCAAATGGTGTCGAGCGCTACTGGGCGAATGTCCATGGTCGTGGCCACGCGTGCACTTGGCACCATCAGTTTGCTGCTGATGGCAGT
CTCGCACGACGTGACCGACCAGAGTGTGCTGTTCCTAGCGCACGGAGCGTTGATGCAGTGCACGGAACCACTCCGGCGATCACTTCTCATGGATTTCGTG
CCCAAGACGCATCGTGCGCGTTGGAACTCGCTGGAGGGACTGACTGTTGCCTCTTGGGCAGGTAGCGCCGTACTCGGTGGAATGATCGTGGAGGCTTACG
GATACCGACTGTGCTTCGTGGCGGCAGCGCTGGTGTATACGTGCGGTCTCGCCCTCGAGACCATGCTCATTCCTCTAACACGGCATGCTGTAGAAACAAC
GGAGGTTCAGAAGCCTCATGCAGAGAGCAGTACGTCACGATAA