Transcript Name :
Phyra_78309
Orientation:
(+)
Number of Exons:
1
Description :
glutathione S-transferase, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glutathione S-transferase, N-terminal22.598PS50404
Glutathione S-transferase, C-terminal-like12.906PS50405
Glutathione S-transferase, N-terminal23.152PS50404
Glutathione S-transferase, C-terminal-like15.689PS50405
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glutathione S-transferase, C-terminal-likeIPR010987
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.541.1660.002
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1254 bases(100 bases per row)
ATGAGCGCCTTCCCGTCCATCAAGCTCACGTACTTTGCGTCCGCCGGTCGCGCCGAGACACTGCGTCTCGTGTTCTACGTCGGCGGCGTTCCTTTCGAGG
ACAAGCGCATCACCCACGCGCAGTTCGTCGCCATGAAGGACTCGCTACCGCTGGGGCAAGTGCCAATCCTCGAGGTGGACGGCGAGGTCTTCACCCAGTC
GCACGCCATGCTGCGCTACGCCGGCAGACTGGGAGGACTCTACCCCGTGAGCGCGCCCTACCTGGCGCTCAAGATCGACGAGCTCCTGAACGCCATGGGC
GAGGTCGAGGAGAAGATGGGCCCGTCGTTCCGCGAGTCCGACGCCGACAAGAAGAAGGCCATGCGCGAGGAGCTGGCCACCGTCACACTGCCTCGCTACG
CCGGACTCTTTGAGGCTCGGCTGCAGCAAATGAAAAAGATCCCGGCCTTCCAGACAGACGACGTGTTCGTGCACGACGTGGTTATCTACGCTTGGATCAA
GTCGCTGCGTGCTGGGTACATGGACTTCATCCCCACGACGGTGCTGGACGGCTACGAGCTTCTGAACGCCTCATACGACAAGGTGGCCAACCACCCCAAG
GTCAAGGAATGGTACACCCTGCAGCACAACACGCCCAAGATCAAACTCACGTACATGCCGCACCCTGGCCGTGGAGAGCCTATCCGCCTCGCCTTCTTCA
TCGGAGGAGTCGAATTCGAGGACGAACGCATCACGCGTGAAGAGCTGGCCAACCGCAAGCCTTCGCTGCCGTTCAACCAGCTACCCGTGCTGGAAGTGGA
CGGCGAGGTCATTGCCCAGTCACTGGGACTGCTTCGCTATGCTGGCACCCTCTCGGGATTGTACCCGGTAACCGACCCGGTGGCCGCTTATCGCGTGGAC
GAGCTGTTCGCGCTCCTGGATGACATGTTCAACTTCCCGCTCTGGGGTGCTTCTCACCGTGAGAAGGACACCGACAAGCAGCTTGCGATGCGCGAGGAGC
TGTCCAACGGCATGGTGGCCAAGACGCTGGGCTTCCTGGAGAACCGAATCATCAAGAACAAGGGCCCTTACGCCGCTGGTGTGAACCTTACCGTAGCTGA
CCTCGCCATCCACGGTGTGCTTCTCGGCTTCAAGAACGGCGTGCCCGGATTCTCCAAGACGATCGCGGACGCGTACACGAACCTGCAGCGTGTCTTCAAG
CTGGTGTCGGAGCACCCGAAGGTTGTGGAGTGGAACACTGCGCACAACCAGTAG