Transcript Name :
Phyra_77830
Orientation:
(+)
Number of Exons:
7
Description :
bifunctional polynucleotide phosphatase/kinase putat
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
BRCT domain9.918PS50172
Protein-tyrosine/Dual specificity phosphatase8.502PS50056
Dual specificity phosphatase, subgroup, catalytic domain17.284PS50054
HmmSmart predictionP-Valprediction_id
Dual specificity phosphatase, subgroup, catalytic domain0.0021SM00195
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BRCT domainIPR001357
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein tyrosine/serine/threonine phosphatase activityGO:0008138IEA
phosphatase activityGO:0016791IEA
protein dephosphorylationGO:0006470IEA
*** None ***
Cluster Id
3938
Sequence
        4095 bases(100 bases per row)
ATGGACGCATTCCTGCGGCGGCGGCTGTTCGCGGCGGACGTGGCGCTTCTCGTGGACCAGACGACGGGTGGGGACGCCATCAAGGAGCTGCATGCGCTCG
TGGAGGCTCAGGGCGGCGTCGTGGTCGAGCAGCAGGCGGCTAACGAGGCTCAAGACGCGCGCGTGAAGCTGCTGCTGCTGCCAGGGGCGCCAGACCAAGA
AATGCTGAAGCTCGTGACCGCCCGCTTCCCCAGCGCTGCGCTGGTTCGCGCCCAGTGGGCCAAAGACAGCGTTCAGAAGAACCGGCGATTGGCCACGGCC
GCCTACCGCGTATTGGTGACCACCGAGACGGCGGAACCGCCGGCCAAGAAGCTCAAGCGCGCGAGTGCCGACCTGTTCACTGTTAAAGGAGATAAAGACT
CAGGTGTAGCACTACCGGAGCCCTATTTCACTCCTTGGAGGACGGTGCAGGACTCGTTGTACGTGCTGAACGCTCGAGCCAAGCAGCAGCAGGAACAGGA
GAAGGTGAAAATTGCAGGCTTCGACCTGGACGGAACACTCATCGTGACCAAAAGCGGCAAGAAGTTTGCCAAAGACCAGGACGACTGGAAGTGGTTCCAC
CCCACGCTCGTGCGTGAGAAGCTGGCAGAGCTGGCGCGTGATGGATTCACGCTTACCATCTTCTCGAACCAGAACGGAGTCGCCAAAGGACACGCGACGG
CCGCGCAAGTGCAGGTGTGGATGCCTGACTGGCAGTTCGTGGGAAGTGGTGGATGTTGACTGGTGTCTTGTGTCTGTTGTACAGAGTAAGCTGGAGGCGA
TCGTGAAGGCGTTGAACCTGCCCATGTTGGTGTTTTTAGGGACAGAGAACGATGCGATGCGCAAGCCTCGCCTTGGCGCGTGGGACGAGATGACGAAGCT
CCTTGCCGCTGACAGTCAAGCAGTTGTCGATAAGGAGGCGAGCTTCTACTGCGGCGATGCAGCGGGGCGGCCCAAGGTTGCAGGGCGCTCCAAGGACTTT
GCTGCGACGGACTACAAGTTCGCGCTCAATGCTGGCATTCGCTTCTTTACGCCGGAAGACCTGTTCCTCGGCTCAAAGCAGCGGATCCACACACGCCCGG
ACACGTGGGAGCTCGGCTTCGATCCAAAGTCCATCGTTATTAGCGCTTCTGCTGGTAAGTCGTCACCAAACGTCAAGTTTATTGCTTTGAACAACTGACT
GATATATGCTGTCTGAAGAACCATTGCTGAGCCCAGTTTCGGCGCAAGTCACCAAGCCAGAGCAAGAAATTGTGGTTCTGGTGGGTTCACCAGCTTCTGG
GAAGTCGTTCTTTGCGAAGACGTATTTGAGTTCGTACGTCCTTGTGAGTCAAGACGAGCTGCGCACAGCTGCTAATTGCAAGAAGAAGGGCCTGGAAGCG
ATCGCACGGGAGAAAAGTGTTGTCGTTGACAACACGAATCGTGACCCGCGCGCGCGAAAGGAATGGATCGCAATTGCTCAGGAAAAGGTTTGTTGTGTTT
TTAAAAACCATGAAAGCGCTGTCCAAATTCTTACAGCTTGTGGTTTTCGTTAGAACCTACCGGTTCGATGCTTCGAGATGGACGTCGACAAACCGCTATC
GATGCACCTCAACACGTTTAGGTCGCTGACGGAGCAGAAGAAGATCCCTGATGTCGCCATTCACGGATTTTATAAGAACCTCGTGCCGCCAACGGTAAGC
GATCGCTGTGCAATGCAAAATGATCGGCGGGTTGTGCTAATGATGGGTGTACGTCGTGTTAGGTCGAAGAAGGGTTCGCAGAGGTCGTGAAAGTCCAATT
TCGAGTCGACAAAACTGTGTCCGACACGCGCCAAGCTCTGCTGCGATCCTATATTTGAAAGCTTGAGCCTCAGGACAAAGTTCACTATTAATACCAGGGT
GTGCTTCCTCTTTGTGATTGCTTCCTGCTACAGAACGGTGAGATATTTTGGGGCTTGCTGATGATAGCAGGAGCGAGAACATCTTACTTCCGTCTGTCTC
ACTCGTGCACTCCTTCGTGAGGACAACAGTGGAGAGCGGCGGAAATTTGGGAACGCGGGAGCGTACGCAATGTCGTCCAAAATCAAGGATGGACTCTTCA
TGGGCGACATGGACGCTGCCCAAGACGCAGACTTCCTCCAGCTGAACGGGATAATGCACATTGTCAATTGCGTACCCCGTCAGGTGCCTAACATTTTCCA
ACAGAGCCTCGGCCTGTCCTACACCGCCTGTGACCTGGAGGATACACTGCGACGACCCTTTTTCGATCTCAAGAACCGTGAATTCACGCACATTATTCAG
CTTATCGACCGAGCGCTCGAGCGGACGGAGAGCGTGCTGGTGCACTCGTTGAACGGTATCAACCGCAGTCCCAGCATAATGATCGGGTACTTGATGGTGA
AATACTGTTGGGGTCTCGACAAGGCGCACGAGTTTGTGACGATCAAGCGCTCGGACATGAAGCTGCACGAGTCGTACATCGACCAGCTGTGCTCTCTCGA
AGCGCAGATTCAAGAAGATCGCCCACAGCGCGCCACCGAGCGTCAGCTGTACGAGTGGAGTACGCATGCGGCTGACCCAAAGAGTGACGAATTTGTGCTC
ATCCACACGTTCCTGAATACCGGTTCGGCGCCTGATGTGAATGATGCAGCTGAACGCGGACGAAATGAAACGGGCAGGCGTTTACGCGGCTTAGTCCCTG
AACGACGACTAACCTGGATCGACCAGACCCCCGAAATGGTATGCCAACCATTCAACGACACCGCACGCTGACCAAAGTGGCTAACTGAAATTATGTTGTG
TTCGTTGTTCAGAGGAAGCTGCATCCCTCGCTGTTGGTCCGGCCGGAGCGTCCGCCCAATCATTCATACAGCAAAATGAGTGCGGTGAGTTCCATGGGCA
TCACGGATTTTTGTGTATTCGCTCTGCTAACGTACGATGGCGACACTATGCAGGCGAACGGATGGGTAGACTTACTCGATCCTTCACCGGCACTTGCCCA
GCAAGCTAAGATTAAGGTAGATTCTGATGCGTGGCGGGAGCGATGGAGCCAGGGATTCTAATACCTGCTACCTTTGTTCATGTATTGTAGGAAATGGCAG
CGGAAGCTGGCCATCTGGCTACTCGAGTAGCCTTTGCCGATCTCTCATCGTCTGGATTGAGTTCCAAGCTTGACCCCCGAGTAGCGAGCAGATATCTTGA
TCAGGGTGAACCAGAGTTTGACATGGCAGGCCCATCGGCTGCAGAAGCGTCGTTGGCACACAACAACAAGCGTCTTCACTCTTTTTCGGCTCCTAAGAGA
ACTGAGGTCCTTGACGATGAGGCATCTACGTCTCCATCGACGGTCAGTGAAGAGCTCGATTTTATGCCAGAGGACGCTTTGGCGGGCTCCAACCCCCGAT
ACCTTCGCGAGACTCTCGCGTCTATCAACTCGCGGCAGCGTCGTCTATCGAGCACCAGCTCCGCTGCTTCGTATCGATCCTCGACGACCGCTAGCAAGCG
TGTGTCGGTTCCAGCTAATGGGCGCAGCAACAGCTCCGGTGCCATCCTCGGCACAACTGGGTCAAAGGAGACAAAGGCAACAAGCGCTGCATCGAAAACT
GTGGCTAAGAAGGCAGGAAAGAGCGCCACGACGTCAAGTTCACGACCAGCTTCAACGACAGCACAAGGTCGCGTATTCTTCAGCGTCGACTTCCCGCCAC
CTCAATCTTCGACGGCATCTCTTTCGAGCCGCAGCCGAGGCGGCCACATCCTTACGGGATCATCTCGTCGTTCCATGGCTGAGCCGCTGTCACAGCAGCC
CCAAACATCCGCCCCGATGCGTCCACGAACGGCACCCCCGCGTAGCCGGAAAGACGTCGAGACGAAGGACCTACTGCAGAGCAAAAAGGTGGATTTGGGT
GGATTCAGTCGGATCACGATCGATCCGAAGTCGCAGTCGTCATACCGCATGCACTCGTCCGTGGACTATACAGACGCCGATACCAACCCCGCTACTACCA
GCTCAACGTCCCGCGGTGCTCGACGAACTTCAGCTTCCTCCACCACTACCACAGGTTATGGCCGAGCTAAGACTGCTCGAGCTTCATGGCGGTAG