Transcript Name :
Phyra_77486
Orientation:
(+)
Number of Exons:
1
Description :
chromosome 20 open reading frame 23, isoform CRA_b
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain8.809PS50195
Zinc finger, RING-type9.568PS50089
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type2.3SM00184
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        909 bases(100 bases per row)
ATGTCGCTGCCGATCGCGCCGCCTGTCAAGCTGCGCCGCCGCAAGTCGTTGCGGGAGGAGCAAATGAGTCGTTCATTCTCGTTCACCAAGCGCCGCGTCG
AGCGGCAGCCGTCGCGCCTCACACCGATGAAGTCCATGGAGCAGACGCTGCTGGACAACGTGCACGTGGAGTTCGTCAAGGCCGTGGTGCCCGGCCAGAA
CAAGCTGGCCAGCCCGCGCTACGTCATGCGCATCAACAACACCGCGCTGGACCAGACGTGGGAGATGGCGAGGACATTCAAGGAGTTCTACGAGCTCAAG
GAGGCGATCGTCCGCGTACTCGACTACGGCCACTTCTGTCCTTCAAACTGCCCGTGGCTCTACATGTACGCGGCGCACCACTTCCCGAGGCGCCACATCT
TCCGTTCGCGTAGCCCTTCCGTGATCGCCGGGCGACTCACCGAGCTGCAAACGTATTTTTCGACGCTGCTGCGCATGGCCAAGCAGAACCGCAACCTCGA
GTGCGCAGTGTCATCTACCAAGCTGCCGCAGCTCATCTACGATTTCCTGTTCGAGGGCATGGTTTTCGACCGCTCCGACTTCATGCGGTTGAGCGAGCGT
CTCTCGATAAATACCCGCGACAGCAGCTTCCTCGACAACGACCCGACACAAGATCCGGAGGAATGCTTCATCTGTCGCAAGGCTCTGGTGGGCGACTCCA
GCGTATCGATCGTCCCAGCAGCTCCAAGCAGTAACAGGGGGCCTTCGAGCAAGAAACGCGATAAGCACGTGATGGCGGGCCTCACGACTCTCGACTGCGG
CCATTGCTTCCACGACGAGTGCATTCTCGCGAAACTAAACGAGTCGCTGACTTGTCCACTGTGTATAGCGCAAACCAGTCCTCCACAGTCCGGCGTCGCT
GCTGCCTAG