Transcript Name :
Phyra_77491
Orientation:
(-)
Number of Exons:
3
Description :
conserved unknown protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
SPX, N-terminal21.753PS51382
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
SPX, N-terminalIPR004331
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.712.750.006
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1575 bases(100 bases per row)
ATGAAGTTCGGCAAAGTGTTGCAGCAGTCGACGCAGATGTCGCCGTCGGCCTGGGAGCCCTTTTGGGCCGACTATAAGCTGCTCAAGAAGATCATCAAGG
ACTGCGCGCAGATCAAGAAGGAGGAGAAGCTGCAGGGCGACAAGCTCGTGAAAATCAAGATCAAACCGTCCGCCAAGGAGGACAACGACAGCATCCGTGA
GTGCCGCGCGGAGGTCGTTTTGATGGACAGGTTCTTATTGGTTCTGATTGCTGGAGCAGGCCAGTCGCAGGATGAAATGAACTTCTTCCGGACGCTGCGT
GTGGAGATCAAGAAGATTGCCGATTTCTTCATCAAGGAGCAGGCCAAACACACGAGTCAGGTGGCAGCCATTGACGCCAGTTTCCAGCAGCTCAAGGTAT
TTGAAAAGAGAAATGCTGTTGATGGGGCTGGAATTCTTTTTTGATAAACATTAGCGTGGAGGTCTAACTGTCAATTTCGCGGTATGTCGTCCAGACGAAC
CCAGAATCCGAGGAAGCCAAAACAGCGCTGATGAAAAACTGCGTGGCGCTGTACAAGGAGCTGCTGCTGCTGGAAAACTTCGCCGTGATGAACTTCTGCG
GCATTTCCAAGGTCGGATCCTAACTATATTGACCGCTGCGTCGAGTCAGGCGGTTCGTCCCCCTGGCAGCGTTTCCGTCTGCCTGACGTTGTTGAAGCAA
CTTGACTCACGTCTGGTTGCCTACTGCGTTGTGCCATTCAGATCTTGAAAAAGCACGACAAGTGGACGGGATATGCTACACGCAACAAATTCATGCACAC
GATCCTGATGAAGCAGCCCTTCGCAACGTATGAGCCGCTGCTGCAAATGATCGACCGCCTTGAGCACATTTTCATGCAGGCAACGGGTTCAAGTATCGAA
CAGCACGATGCGCAAAAGTCGTCCTCTCGACGCAGTGGTGGTGGCGGTAGTTCGTCCTCCTCACCTTCGGGGGAGGCACCCGGCAGCTCAGGCCCCACCT
CAGGCGGCGGTGATGTCGGTGATGACACGTCTTCTGGTAACAATAACTCATCAAGCCATTCGCCAAGTCACACTCCACCCGGCGCAAGTGGCAGCCGCCA
TGACGGACGCAGGTATAGAAGCTCAGTGGATGAAGCTTCACCACGGTCAGAAGATTCAGTCACACTCGTACGAGTAAACGCCCTTCGCGACGATGTACGA
CAACTTCGGAAGATTGAGAGCGCGTATGACGGCGATGGAGAGTACGAGGACAATCCGGATGACTCAAATTTCCCTGACGATGATGCTGAGGTGCCGCCAC
TGCGCTTTGCCGGTCGTCCCCAGGAAGAAAAGCCCATCCTGCCTCCAGTGCTAGTGCGTGTTGCCCCTGCCGGTACCCAATCGGACAGCGATGCAGCTGC
AATTGCGATGCTTTCTATGAAAGACAGCGCTGGTTTGCACGCGTCTGGAATCAGCAGCGACGGCGGTGACAGTGCCGCGGAAAGTTGCCGCACTCGGAAT
GCTAAGCGCAAGGCCTGCGCGCCGCTAGACATGGAAGGCAAGCGCAAAATGAGCGTCACAGCAATTCTCAACTAG