Transcript Name :
Phyra_77487
Orientation:
(+)
Number of Exons:
2
Description :
G patch domain-containing protein 1
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
G-patch domain10.869PS50174
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
*** None ***
Cluster Id
4077
Sequence
        2459 bases(100 bases per row)
ATGAAGCGTGGGAACGTCCGCAACCAGGAGGTGCGTATCCCTCTCTGTCTCCCCCTCCTCGCTGTACCGACGGGCTTTTTCTCGGATGCGATAGGTAGTC
AAACTCATCGTCTATCACTTCCACCGCTTTTCCGCAGGTTACGGACGAGCAAGGCCGCCGGCGTTTCCACGGAGCCTTCACGGGCGGCTTCTCTGCTGGA
TACTACAACTCCGTGGGTAGTGCGGAAGGATGGACGCCACAGACGTTCTCGTCTTCTCGGAGCAATCGCTCGTCCCAGATCCAGCAGCGGGCTGAGGATT
TTATGGACGAGGACGACGACCCGCTGCTGGGCAAACGACTGGAGACCACGGAACGCTATGACACGCTGCAAAAGGGAGCCAAACGACAACTGCAACAGCA
GCAACAAGTTGGCAAAGCTGGAGCTGCAGCTATCCCAGGGTTCGCCTTGCCGGATGACTGGGTTCTGCCGGTGAACGACTCCGTTGGAGCTAAGTTGTTG
AAGCACATGGGGTGGAAAGAAGGTCACGGCATCGGGCAGCGAGTACGCAGACGCAAGTACGAGGAAATGGAGAAGGAGGGAGTGGAGGGACCGAAACTAT
TGATGCAAAGTGCTCATGAAGAGAAAACAGAGTCAGAGCCGCAGGATGAAGAAGAGGTGTACGTTCCGCCACGGAAAGTGTTTGACATTCAAAAGGCTTT
TCCCAAGCCCAAGCTGGATCGGTATGGCGCGGGATTTGACCCGTATACGAACGCTCCCGAGTTTGCGTTCCACAAGCAGCAAAAGGAGGAGAATCAGAGA
ATGAAGGAGGGGTCTCACCGTCAGGTGGTATCCTTTTCAGACGCTTTGAAAGCTTCAAATGGCAGCAATCGCGCATCGGGAGGATATGGACTGAGCGCGC
TGGAAGAAGACGACGACGTCGATGTTTATGGAACTGTCTCAATGACAGAATTTGATCGGGTAATTGCCCCACTTGGAGCGAAGAATGACATTAAGCGGCT
GGATTCATCAGCACTACCCGCGCGTCGGTATGAGAAGGCAAGACTCAGTCGAGCTTTGTGCTCAGATGGACGACCTGTCCTTCCTGGGTTTGAGTTAGCA
ACGTCGAAGGAAAAGCCTCCGAAGGTAGTTAAATTGCGTCTCACTGTGCCGTCGGATTTCAAGGCCTTTCATCGCTTTGATGAGGAAGGAGGGCGCGATG
ATGCCGTAACAGCGTTGTATCGCAAGCATAATTTCTCCTCGGGTAGCGGTGGAATGGTTGTAACAGCGAACCAACGTGGCGTTCTCCTGGAAGACCAAGG
GGGAAATGGACGTAGCAATGCTGGCGCGGGAGTTGGTAGCGAGGTGAAGGGCCCAGCTGCGAGTGTGTTTGACTTGCTTGGCGAGGAGCAGAGGGCGAAA
CTGTTCGATGCTGCTGCTCAAGCGAAACAGGGGCTACCTTCGTCCAGAGTTGCACATACTACTTCAGTCAAAGAGTTAGCCGCTCCGAAAGTTCGGCAAC
CACTTGTGCGTGGTGGTAGTGGTGACGACCAGTTTCGAGCAACGATTTCAGCGTCGATTGCGAAACGATTCGTTTCGTCAAAAGGTGCAAGCGACGAGGA
AAAGAGCAAGCCTGATCCTACTCAAGAGGTTCACACGAAGGCGTCACGCCGGTCGCAGAGTTTGTGGATCCCCGAATCACTTCTTTGCAAACGTTTCCAC
GTAAAATGTGCCGGACCGACTGGCTCTGGGGTGAAAGATGACGATAGCGACAAGAAGCGTGACCTCTTCGACAAGGAGCTCGTTCCCCATTTAGTAGAAT
TTGCCGCTGACCGAGCTGCTCATCAGCGTCCGCCAGAGAAGGCACGTGAAGCTTCGAAATCGGGCAAGGTTGCTGAAGATGAACGCGTGCTGCCACCTTT
ACCTGCAGTAAAACGAACCTCGGCCAGTCTGCTCAAATCGATTTTCGAGCCGTCGGATGAGTCTGAATTGAGTGACTACGATAGCGAGGATGAAGAAGGC
GATGACGGCAATGTAGAAGAGATGGAGAAGCAAGATTCTGCCTCGAGCTTTCCCATCGGGAGTGCTGAACAACTAGTGCGAAATCATCAGCACGACCAAC
GTGACGTGAGCTCAGAGTCAAGCTCGTCAGAAGATGAGGTTGGTGCTCACTCCTCGATGCTTGGCGCTAAAGTTGGCAATAAAGAAGATGACCGAGGCAT
CAAGCGACTGCGCAGTGAAGATGACACCGACAATGGAGATGCGAGACAAAAAAAGAAGGACGAGAAGCGGAAGCACAAAAAACACAAGAAACACCACAAG
CATCGCTCGTCGCGTGACGACAAGGACAAGAAGAGGAAAAAGGACAAAAAGGATCGAAAGTCGCACAAGCACCGCTCCTCGAGACACTCCAGGCGAAGCA
GAAGTCGAAGTGGGGAACGAAGCTCGGGTCACCGTCGTAGCTCCAGCAAACAGCACTAG