Transcript Name :
Phyra_77490
Orientation:
(+)
Number of Exons:
3
Description :
predicted protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
MSP domain23.848PS50202
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
structural molecule activityGO:0005198IEA
KO ID
K06096
Cluster Id
1971
Sequence
        1095 bases(100 bases per row)
ATGGCGAGCAGCGGCGTGGACGTGGCGCTCGCGCCCAACTCGAGCGTGATTCTAGAGCCGGCGGACTCGCTGTCCTTCCATCTGCAGCCGCAGACGGCGC
CCCAGGCGGTATTGACGATCCGCAACGTGGCGGACGACCGGCAGATCGCCTTCAAGGTCAAGACGACGCGGCCGCTGCGGTACCTGGTGCGGCCCAACCA
GGGACTGCTGGGGCCCAACGGCTCGGCCTCCGTCATGGTGATCCTGCAGCAGAAAGACTGTGACGAGCTGCTGCGACTGGACCCGGCCGAACGCCAACTG
GCCAACGACAAGTTCCTCGTGCAGAGCATCTACGTGGACGACAGCTTCTACGAGCTGGTCAAGACCAAGTCCACCAAGGAGATGGCGGACGAGCTCACCA
ACATGTGGGCGCGCACGGACAAGCGCGCGCTGTCCAACAAGAAATTGCGCTGCCGCTTCGTGCAGGACAGCGAAGAGTTGGGCCGTCCGCCGTCGCCGCC
GAGTCCACAGCGAGCGCCGTCGGCCAGCGCCTCGCCGGCCAAGACAGCGACCACGTCGGACATGAGATACCAGAGTAGACAGAGCGACGAGGTCGGGGAC
GAGGTGGCCACGCCCGCGCAACTGTCGTCGGCATTGCTGCAGGACGACAAGCCGCAGGCGCCGAAAGTGGCGGAGAACAGGGAAGGAGGCAAGGAAGCGA
TCCAAGAAGTTGCGGCACTTCGGAAGAAATACGACGAGGTAGGTGCAGGGTTGAGGTACTGTGGTGACGAGTGGGGCTAATGGAGGTGCGTTGTGTGCTT
GATGGTGCTCAGTTGGTGGCGTTCACAGTGCAGCTTACGGCTCAGCGCGACGTGTTGATGAGCGATCTGGACAAGACGCGGCAGCTGCTGCAGAAGGCGA
GCACGGATGCACAGCGCGTGAAGAAGCTTTCAGAGGAGTCATCGACTCTGCGTCATCGGAAGAACAACGGAAACGGAGCTTCTGGTACGGAGGACTCGCA
GGCGATTACGGGAAAGGGTCCCAAGGAACAAGGGGTACGTCTTGGCTCATGTTGATACGATAGGCTATGCTGGCAACTGACAGGTTTTGCTGTGA