Transcript Name :
Phyra_77488
Orientation:
(-)
Number of Exons:
1
Description :
nucleolin, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA recognition motif domain16.773PS50102
RNA recognition motif domain18.7PS50102
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain1.3SM00360
RNA recognition motif domain4.1SM00360
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.6171.930.004
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
KO ID
K11294
*** None ***
Sequence
        1422 bases(100 bases per row)
ATGGCCAAGAAGGTGAAAACGCCCGTTGCCGTGAAGCCTGCGTCCAGCAGCGACAGCTCGTCGTCTGACTCGAGCAGCGACGAGGCCCCGCAGAAGAAGG
TGGTGGTGGCCAAGAAGGTCGCTACCAAGAAGCCCGTGGCTTCGGACAGCTCGTCGTCCGACTCGAGCTCCGACGAGGAGGAGGCCCCCAAGAAGGTGGT
GTCTAAGAAGACTGCTGCCAAGAAGGTGGTGGCCAAGAAGGAGAGCTCGGACTCAAGCTCGGACTCTTCTTCTGATGAGGAGGAGGCCCCCAAGAAGGCC
GCCCCGGCCAAGAAGGTTGCCGCTAAGAAGGAGAGCTCGGACTCGAGCTCGGACTCTTCGTCTGATGAGGAGGAGGCTCCCAAGAAGGCTGCCCCTGCCA
AGAAGGTTGCCGCTAAGAAGGAGGACAGCGACAGCTCGTCCTCGGACTCATCGGATGACGAGGCTGAGAAGCCGGCTGCCAAGAAGACTGCTGCCAAGAA
GGAGGAGTCTTCTTCGTCGTCCAGCGACTCGGACTCGTCCTCGGACGAGGAGGAGACCCCTATTGTGTCCAAGAAGCGTAAGAACTCGGACGCTAGTGAG
AAGTCCAACAAGGTCCACAAGCAGGAGGACGGCGAGGCCGCTGCTGTTGCCAACCCGCAGAAGAACCTTGAGGTCTTCATTGCCGGTCTGCCGTGGTCCG
CCACGGAGGAGGAGGTGACGGAGCACTTTGCCGGATGCGGTGAGGTGACTGGCGCTCGCATCCCTCTGCAGAACGGCCGCTCGTCGGGTACTGCTTTCGT
GACTTTCGCTACTCCGGAGGCTGCTGAGGCTGCTCTTGCCATGGACGGCCAAGACTTTGGAGGCCGCTGGATGAAAATCCGCACGGCCGAGAAGAAGAAC
ATGTTCGACGAGAAGCCGGAGGGCTGCACGAGCGTCTTCATTGGCAACCTGTCTTGGGACGTGGATGAGAACACCATCCGTGAAACCTTCGGCGAGTGTG
GTGAAATCCTCAGCTGCCGTTTGGCCACGGACCGTGAGACTGGCGAGTTCCGTGGCTTTGGCCACGTTGACTTTGAGACGACTGAGGCCGTCGACGAGGC
TGTGAAGCTTGCTGGCTCGTACGTGAGCGGCCGTGCCATTCGCGTCAACTACGCCAAGAGCCGCGAGCAGCACAGCGGCGGTGGCCGTGGTGGTTTTGGC
GGCCGTGGTGGAGGCCGTGGAGGCCGCGGCGGATTTGATGGTGGCCGTGGCGGTGGTCGTGGCTTTGGAGGCCGTGGTGGTGGCCGTGGCTTCGGAGGCC
GTGGCGGTGGCCGTGGCTTCGGTGGTCGCGGCGGTGGCCGTGGTGGCCGTGGTGATGGTCCCCCCAGACGCCAGCCGTCGTCCATCCAGAACTTCCAGGG
CAACAAGAAGACCTTCGACTAA