Transcript Name :
Phyra_76197
Orientation:
(-)
Number of Exons:
4
Description :
Intraflagellar Transport Protein 140
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain15.373PS50294
WD40 repeat10.041PS50082
WD40-repeat-containing domain9.098PS50294
HmmSmart predictionP-Valprediction_id
WD40 repeat8.2SM00320
WD40 repeat0.13SM00320
WD40 repeat160SM00320
WD40 repeat5.1SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4749 bases(100 bases per row)
ATGGCATTGTTTTACGACTACAATGTGCAGGTGCCGGCGAATTTGCGACAGGTCTGCTCGGTCTGGGGAGAGCTGGACCCGGTGCTGGCCGTGGCGCTGG
AGAACCGAGAGATTCACTTCTTCACGGATGAGGTACTGGCAGCAAATAGTTTGGTGGGTAACCAATAGATCCGAAGCATTAACCGGTTGCATGGGCCCTT
ACTCGATGTAGGGTGAGAAGCAGCAAGGTCTGGAGAGCTATTCGCGCAGTGCCGACATCGTCTCGATGGCCTGGCAGCCTCGTGGCGGAGCTGTCGCGGT
CGGATGGAGCGACGGTATGTTGGATGCCTTTGAATTAATACTATCAACGCGCACTGAGTCTTGTTGGCTTGTGCGGGCCAGGTATGGTCTCGCTGTGGGT
ATTCAAGGAACAGTCGGCGCGCGAAGTGAACTCGCCGCACACGAGCCGCGTGTGTCTGTTGAAGTGGTCCCCGTCAGGGAATCGACTCATGTCTGCGGAT
GAGAACGGAATATTTGCCGTGTGGAAGGTGGATAGTCGGTGCCAGCTAACCCTCAGTACGCAATATGCGCGTCAAGGTAGCTTCACTCACTGTGTCTTCG
CCACTCGATCAGCGCCACCAAAGGACAGCCACACCAAAATGTGAGTATATGTTACTTTCCATAATGGTTCTGCTAGCTATTGCGCTAATTTGCCTCGATT
TTGATGTCTTTGTGTTGCTTAGGGAGCATTTTTCTCAGCACGCGTGTCCACAGTTCTTTTTCGGTGGTGAGATGGGGTCTGTACACTATGCCGACGATTT
GGGCCACATTTCGGACATTCAGGTGCTAAACCACGCAATAGAGTCGATGATGTTTTTCGAGGAGCAAAGCCGCCTCATTGTCATCACACGGGCGGTGCAG
CTTATCGTGTATCAAGTGGGCGTCACGGACGGCACAGTAAAGCCAATTACTAAAGTCAAGCTGAGTCTAGCGGGAGAAGGTTCACTGCTGGAAACAAAGT
GGGCTAGTCCGGGGCTACTAGCAATTGCGTCTGGCGAACCACTTGTGCGGTTCTGGAACATTCGTACTGAAGAGAACAGTGTATTGAGTCTACCAAAGTC
AAGTGGACTCAATTACAACGTCAACAATTTGAGTTTTTCCCCGCGAAGGCGCGTTCTCGTGGCGGGTACAGCTCAAGGGGCAGTTTTCTTTTGGCGTGCC
ACGTCTTTCATTGACACGACGCAAGGTACTGGAGACTCCGCAAATGTGTCGTACCGATGGGACTTGCTCTTCACGGCAGAAGTGGGTCGTGCAGTCACAC
GTATCGGCTGGAGCAATGCCCACCCTGCGTTGTACGCCAACACCGTCGAAGGAGTGGTCATTTTACATGAGGGCAACATGCAGCGTGCACTTAGTGGAGA
TACATCAGTCATTCAAATCCGACCGAAGACACTCTCAATCGAGAAGTTCCAAGATGGAGCGCAGTCTGGTGTGACAATCACACAGTCGACACTTGAAGCA
TCGCTATGTGTGAAGGGTGTTTCCCACGACGGATCAACGCTCGTTGTTTGGAACGGATCAAAAGCAGAAGTGTACGAAATGAAAGATGGAGATGCCAAAG
TCACTAATCAGTTCAAGTGTTTTTCGAGTGCTATGGTGCTTCGCGGTGAATCCATTTATCGGGCAAACGGAAATCATGTCGAGGTTTGTAACCTTGCAGG
AGTAGTGAAAAACACCATTTCGTTCACGGAAGCCGAAGGCCGGCCGGCGATGCTGTCACTTCAGAACAAGTTTCTTGCTGTGGGTACGGATCGGGGCCTA
TTGCGCGTATTCGACGTATCCCGCCGTGACCCCAAAGCTTTAGGAAGCATGGGAAATCTCCCCGAAGCTTTTGGAGAAGAGACCAAGTCTGCTGTGATGC
GAGCAATCTGTGTCAACTCGGACGGCACTCGCATCTGCATTCTTGCTGACCGCGTTGAAGGTGCTTTGCTAATGCGAGAACCATTGAACAAGCTTTTCCT
GTTTCAAACGGATCTCAACATTTACCAGCAGTTTGACTTTGGCTCTTCACGCTACCCGACCTCAGCTTTCTTCGATCCTCAAGAGCCACGGTTGCTTATC
TGCGAGACTGTCAAGACAGGTAATGATAGTGCGTCGACGACATCGGGTGGAGCTGCTGCTGGTCGTACCGACGACGGCTTGGGGACTGGTGGTCCCGGTG
GTGCGCGCGGGAACCAAGTCTCAGACAAGGAGGTCACCATCATTTTTGCGTCAAACGAGCACGGCCTACTGATGCAAGACAGTTTTGACCTTGATCTGAA
GTACTCCGCGCTACTAGGTATTCAAGTTCCACGTGTATATTTCGTGGCAAAGGTGGACAACAGCTCATCAGATGACTCCACAACCGTAGTGCATGTTGGC
CGGACCAAGGCTAACAACCCCGTCACTAAAACTCCCATGGTTTACGACACCATTAGCTATCTTCGCACACAGATCATGCGCGACTTCACGGGGCTGGATA
AGGTCAACAATGAGGCGAAGCAAGCTCTAATCGACTTTTGCTACTTCATGACGGTCGGTAATATGGATGAAGCGTACCGCTCAGTCAAACTCATTGAAAA
TCCGTCCGTCTGGGAGAACATGGCGCGCATGTGCGTGAAGACGAAGCGGCTGGATGTGGCTGAGGTATGTCTCGGGAATATGGGCCATGCTCGAGGTGCG
GCTGCAGTGCAAGAGGCAAAGAGAGAACCTGAGCTCGAAGTTGCGATTGCCATGGTAGCAATTCAACTAGGCCTTCGCGACGATGCAGCCCGTTTGTACC
GCGAGTGCGGCCGCTACGACCTCCTGAACAAACTCTATCAGGCCAGCGGATACTGGAAAAAGGCTGTTGATGTAGCGGCCAAGCGCGACCGCATTCATCT
CAAGACAACTTACCACGCACTGGCACGACACTACGAGGAAATGGGAGATCTGAAGGAGGCGATGGAAGCCTACGAGGATGCTGGCACTCATCAAAAGGAT
ATTCCTCGCATGCTATTCAAGCTGGGCAAGGTGGACATACTCCAGAAGTACGTAGCAACTTCAAACAACCGCGACCTGCTAATTTGGTGGGCTCAGTTCC
AAGAGAGCCAGGGACAATTTGATGCTGCCGTAGAAAGCTATCAGCGTGCCAAGGACTACCTGTCCATTGTACGCGTCTTGTGTTTCAAGAAAGACTTCCA
GACGGCTGCGAAAGTAGCACAGACGAGCGGGAATCGCGCAGCAGCGTATCATCTGGCCCGGCAATTCGAGGCGCACAACGAAATTTCCAACGCTATCCAT
TTCTTCGCAAGCGGTGGTTGCTACAACCATGCCATTCGTCTGGCCAAGGAGCACCGCATGGACGCCGACCTCATGGGCTTCGCGCTCATGAGCAAGCCCA
GTGATATGCTTGATTGTGCTGCATACTTCGAAGAGCAACATGAAATGGAGAAAGCCGTCCAGCTGTACCACAAAGGAGGAAACGTGGCTAGGGCCCTCGA
TTTGTGTTTCCAGGCCCAACTCTTTGAGGAGCTGCATCACCTCACGGACGAACTCAGTGGCTCTGGCAACACTTCGCCCGCTATCTTGAAAAAATGCGCT
GACTTCTTCATCGCCAACGGTCATTTCGCTAAGGCCGTGCACTTGTGCTTGATCGGACATCGCGTTGCAGAGGCTCTGGATGTGTGCATGCAACACGATG
TGAAGGTTACTGAAGAGATGGCGGAGAAGATGACGCCTCCCAAAGGTGATGACACCGCGTCGCCGGCTGACAAGAAGAAGCGCACTGAGCTACTGCTTAA
GCTTGCCAAGTGCTGCAAGCAGCAAGGCTCGTATCACTTGGCCACGAAGAAGTACACTCAAGCCGGCAACAAGCTTAAGGCCATGAAATGTCTGCTCAAG
TCCGGCGACACTGAGAAGGTCGTGTTCTTTGCTAACGTATCGCGCAACGCCCAAATCTTCGTTCTGGCTGCGAACTACTTGCAGAATTTGGATTGGCGCA
AGGACCCGGAAATCCTGAAGAATATCATGGGGTTCTACACTAAAGCACGTGCATTCGAGCAGCTTGCAGCCTTCTATGCCGGTTGTGCTCAGGTGGAAAT
CGAGGAATATCGCGACTACGAGAAGGCAATTTCTGCGTTGCAAGAAGCCGTTCAGGTGGTGTCCAAATCTCGCGCAGACGGCAAGGAAGCACTGCTGAAG
CGTTATGAGAAGCGCATTCTGCTGATCGAGCAATTCGTCGTCGCCCGACAGCAAGTGAAGCACAACCCGAAAGAGATGATGGACATTGTCACCAAACTGC
TGGAGGAACCAGGTATTGAGGAGGCTATCCGTGTGGGCGACGCATATGCAATGCTAACAGAAGCGTACTACGAAGAAGGCGAGCTGAACAAGAGCTTTGA
GACGATGGAGGAGATGAACCGTAAGGGGCTCACAATCAAGACTTACGTCGACCCACGGGTGGTGGAGTCCGTGCAAGCGAAGTTAGGCGTTTCTCTGGGT
GACGACCGACGCCGCAGACCCTCGCCCAGTGACTATAAGCAGTCTGCTTCGTCCAACCGACCCGGTTCGCGTGATGCCAAATCCAGTCGCCCAGAATCGC
GTCCTGCCTCGCGTGAGGCTCCCAGTAGTCGCCCAGGTTCTCGTGAGGCGCAAATGAGTCGTCCAAACTCGCGCGACGACAAGATGGGGCGTCCTGGAGA
CGATGAGATTGAGGACGAAATGGAAGAAGACATCGCCGACGACGAATGA