Transcript Name :
Phyra_42484
Orientation:
(-)
Number of Exons:
1
Description :
phospholipid-transporting ATPase, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase1.8PR00119
Cation-transporting P-type ATPase1.8PR00119
Cation-transporting P-type ATPase1.8PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
Cluster Id
12
Sequence
        2166 bases(100 bases per row)
ATTTACCACCCCGAAACAGACACCCCGACATTAGTGCGCTCCATGTCGCTCAACGAAGAGCTCGGGCAGATTTCGTACATTTTCTCGGACAAAACGGGAA
CACTCACCTGCAACGTCATGGAGTTCCGGAAGTGCTCCATTGGCGGGGTCTCCTACGGAAACGGAACCACTGAGATCGGGCTAGCGGCACTAAGGCGTGC
CGGCAAACCCCTTCCAGATATGACCGCACAGTCTACGGGGCCCAAGGTTCCTTACGTAAATTTCGATGGTCCCGAGCTGTTTAATGATATGAAGGGGGAC
TCAGGCTCCGTCCAACAGGGACGTATTGATGCCTTCTTCACGCATCTTGCAGTTTGTCACACCGTCATCCCAGAGCGGCATGAAAACTCCAAAGAAATCA
CGCTGTCGGCTTCATCTCCTGATGAACAAGCACTCGTTGCGGGTGCAGGTTACTTTGGATATGAGTTCGTAAATCGATCTCCGGGTGTCGCTCATGTCAA
AGTTCGTGGAATAGTACAAAAGTACGAGATGCTGGACGTTCTCGAGTTCAACAGTACGCGAAAGCGTATGAGTACGATTATCCGTCACCCAAATGGACGG
ATCTTCTTGTACTCCAAAGGTGCAGATGTTATCATCTACGGATTACTAGCGAAGGACAAGGAGGACGAATCTACTTCTTCCCAGCTCCAGGAGATCACTC
GGCGCCATATCGACCAATACGCTGAAGACGGACTGCGGACTCTGACGATTGCGGTTCGTGAAATTGAGCGTTCGTATTACGCCGAATGGGCAACAAGGTT
CCACGACGCGCAGAACAACCTAGCGGAAATCGACAAGCGAAAGAAGGACCTCCCAAACGCAATTGACCAATGTATGAACGAGATTGAGTGCGACTTGGAG
CTGCTTGGGGCCACTGCAATCGAGGACAAATTGCAATCTGGTGTTCCTGACGCAATCGCCAACTTGGCGTGTGCGGGCATTAAAATCTGGGTACTCACTG
GTGACAAGGAGGAGACGGCTATCAACATCGGCTTCGCTTGCCAGCTTATAACGAACGACATGAAGCTTTTTATCATCAACTCGAAAATCGCAGCAACTCC
CGAAGTACTTGAGAGCACGCTAAGAGATGAGATTGGAGCCCGCAGTGCAGATGTGACTGTCTACCTCGCTTCGCCTCCCAGTACGAGAGGTGATCTCCGC
GAGTTGGCCCTTGTCATTGATGGTGAGACGTTAATGTTTGCCCTTCGCGGGTCGTGCCGTCCTCTGCTCGCCGAGTTCTCGCAATACTGCAAAGCTGTTA
TCGCTTGCCGTGTATCACCAGCCCAAAAAGCGGAGATGGTTGCTTTGATCAAGGAGTACGTACCTGGAGTTCGTACTCTTGCTATCGGAGACGGAGCGAA
CGATGTTTCAATGATCCAAGAAGCGCACGTCGGTGTGGGAATTTCAGGCCAAGAGGGCATGCAAGCTGTCAACTCCAGTGACTATGCTATCGCGCAATTT
CGCTTTCTGCAGCGCCTGTTGCTTGTGCATGGTCGTTGGAATTACAGGCGAATGGCTCAGCTAGTGTTGTTCATATTCTACAAGAACATCCTCTTCACTG
CTGCTCAATATTGGTACACACTGTTATGCGGGTTCTCGGGACAGAAGTTTTTCTTGGAGAGCGGAACACAGCTGTACAATATCGCCCTGACGGCCATTCC
GATCGTTGCCTCCTCCATTTTGGACCAAGATGTCAACGACGATGTAGCCATGACATTTCCGAAGCTCTATTTCACGGGACCTCGTGATGAAGACATCAAC
ACCAGCACCTTCTCCTTGTGGGTGGTTGGAGCGATCCTGGAGAGTATTATCATCACGTTTATCACAATTCACAGCATGAACAACGCGGGCTTCTCTGGAG
GCAGTCCGTCGATGTGGTTGGAGGGCTTTATCGTCTTTACCCTTGTCGTGACTATCGCCAACTCAAAGTTGTTCATGTTCCAGAACAGTTTCTACTTCTT
CAACTACTTTATCTACATGGGCTCAGTTTTGGTGTGGCTTCTGGTTGCATTGGTGTGCAGCCACGTTGCAATGCTCTCGGACCTCACATGGGAGTTGATG
CTGGAGCAAGCTTTTGGGCTTCCATCCTTCTGGCTGGTCTGTTTGTTCGTCCCCGTGGCAGCGCTC