Transcript Name :
Phyra_41112
Orientation:
(-)
Number of Exons:
2
Description :
predicted protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.7392.4270.005
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2171
Sequence
        443 bases(100 bases per row)
CAGAATAGTCCGCTGTACATCCGCACGTTCGGAGAGGAGGGCGAGGACTTGGGCTTCCACTACATCGCGCACGTGTCGCTGGACGTCATCGAAGAGAAAC
TGCGCGGCGCGAGCGTCACCACGTCCAAGGACGACATGTACCTGGGCTTCCTGGGGCCCATCGAAGATTATCGAGTGTACGGATACGTCACCAACACTTC
AGTCAAGTTCGTGGTGGTCCTGCAGGACGCCCCAGTACGCGAGTCGGAGCTAAGACCGGTGAGCTCTTGAATCAATTGCCATGGTGGCTAGGGGGTTGAT
TTGACCTTGTGTATGGCGGTGTGTGACTCCAGTTCTTCGCGGAGGTGCATCGGCTGTACGTGAACGCCATGTCGAACCCGTTCGCGCCGCTGGGAGAGCG
CCTCACGTCGCAGACTTTTGACAAACGAGTGTCCAACCTCGTC