Transcript Name :
Phyra_75404
Orientation:
(-)
Number of Exons:
3
Description :
cleft lip and palate transmembrane family protein pu
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Sterile alpha motif domain5PS51257
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4730.70319
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
2509
Sequence
        1997 bases(100 bases per row)
ATGGGGATTTTCCGGACGCTGTGGACGTGGATCACCTTCACCACCGTCTCTTGCGCCATCTTTGTGAGTGTTTTGCTGCGTCAGCGGACGTCTAGAGCGA
TCTGCAGCATCAGAAATGCGGGGATGCGGTCTAACGTGGAATGTTGCTGTTTATCTCGCCCTCTGCTGCTGTATATGGATGTTATGATGTTGTTGCGGTG
CTATATGACGTCTGTAGTCGGCGTACATGGCGTTCGTGGGTCGCCAGGTGCGTTAGAAGACGTGGTCACTTGAAGGAAGTATACCTATTGACAGTGGAAA
CTTGACAGGTATACCGGATCATGTATCCGACGTTCTCCGACAGCCCGAACACGCTGGACCCGCTGTGGGGGGAGGGACAGCCGCTCGACGTGACGTGCTA
CGTATCGCCTCGTGCTGAATGGGACGTGCTCGAGGACTTCAGCGCTGGCGCCGTGCACGTGGGGGTCTTCAGATCGCTCACTTTCGACTGGACAGACTCA
AATTCCAGACACTTGGACCTCAATGTCTCTCAGCAGACGCTGGCAGAGTTCGCAGACGACTCTGGGGCGGGGGGCCAGGTGTGGGGTGTTCTAAAGAGCA
ACGCCTCCGTGTATCTGCATGTCCACGTGACGCACTCAGGCTTCTCGCCAGACCCGAAGGATGCAGAGCACTATGACCAGTACAGGACAATCCACCAGTC
CTCTAGTCTTGTGAAATACGCACCGAGACCCAATGCAAAGAACACTAGTTTGTTGCTGGCTCATGCCGAGCCTCAGAGTGGAGCTAAGTCCTGGCAAGAA
ACAGCGACGATTTCCTACTGGAAACCAGCGGCGAGCGTGAGACTCGTGACGGACTTCACGCGCTACCCTGTGGAGGAGCTGCCAGTGATGGTGTACCAGA
ATTTGCGCTACGTGCAGCACCCGATGGATAAACGTTGGCGCTACCTGCCAGCGCTATACGTCGACGACTTGTCACAGACGCAAGATAAACTCGTGCCCTT
GAACGCGACGCTGGACAATGGCAACGGAGGGGAAGTCGTGCTTCCGCTGCAGCTGTCGTGGTCTCCGCTATCCTTTGCTCGCTGGCAGATGCAGCTCACG
TTTGCGACGGTGTTCACATCACAGGAGCAGATGGGTGTGCCTTCCAGCGACTTGGATGCCCTCCGCTCCATGGTGACCGACACGCACCCAGTGCTGCTGG
CGGTGACCATGAGCGTGTCGCTCCTGCATTTGCTGTTTGACTGGCTGGCGTTCCGTCATGACGTGTCGTACTGGCGGTCTAAGGGCGATAATGTTGTTGG
CGTATCGCTGCGTGCAATGGCAGCTGAGTTGGGCTCACAGGCGGTGGTTCTGTTGTACCTGGTCGACCAAGATTCGACGCTTCTCGTCACAGGCCCGCAG
TTCATCAGTGTCGTGCTGCTTGTGTGGAAGGTGACCAAGGTCTGGCGGGCCCAGCGTCGCCATCTCGCAATCAAGTCCAACGTTGGTACTGATGCGGCCT
CTGACAAGGAGAAAGCGATGGACAAACACAGTTTGCGTCTACTGGAGGAGACTCAGCGTGCTGACTCGCTGGCAACGTCGCACATGTTGTTCGTGCTTGC
CCCACTAGCTGCTGGCTACGCTGCGTACTCGCTACTGTATGTTGCACACGCCGGGTGGTACGCCTGGCTGCTCGAGTCTCTCACTACAACGGTCTATGCG
CTGGGTTTTGTGTTCATGCTCCCGCAGCTGGTCATCAACTACAGGCTCAAGTCCGTGGCACATCTGCAGTGGCGGCTGCTGATCTACCGCGCACTCAACA
CTTTCATCGACGACTTGTTCGCGTTCGTCATTAAGATGCCGACGCTCCACCGCATCTCGTGCTTCCGCGACGATATTGTCTTCGTCATCTATCTGTACCA
GCGGTGGATCTACCCCGTGGATGTCCAGCGGCTTGGAGACGTCGCCGATGGCGCCCCCACGACAGACCAATCGTCTAGCAAGCCCCACGCTGAATAA