Transcript Name :
Phyra_75407
Orientation:
(+)
Number of Exons:
4
Description :
N-formimino-L-glutamate deiminase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.8945.550.011
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1605 bases(100 bases per row)
ATGTTCTGGCCCACCAGTTTGTCCAACAACGCTACGTTTCCGTCTTCCGTATCGAAATTCCACAGGTGGGGGAATATTTTTCGCACTGTTGACCCCGTGA
GTGTGAATGAGGTCGTGGTGGTGGCGACCACAGCATGCGAATTCTCCTTCTGCAAGCCTTCCAGTTCCACCTTGATATTTTGGAACGAGATCGAAAAGCA
CCTCCAGCTATGAAGCAGTGCTTCCGTACCACATCCTCCATGGGACACCACGTTTGGAGACAACGCGGCCTGTACGAAGTCGAGTTGGTCTCTGGACGGC
AGTGCGTCGGATGCTCCAAAACTGTCAAAGGAAAGTCCGTCACGAAACACTCGAAAGTACGCGACTGCCACGCTCCAAATGCTTGTTTCGAGCGGGATAA
CGGAAGGCAGGTCAGGCTGTCGTTGCTCGCGTTGCTGAACCCGTTGCTTGATTTCTTTTCGTAGTTGTTGAGTGTCTTCCTCAAGACTTTTAATGCGATC
GCTCTGCTTCTTTCTGTATCGCCTCTCGTTGACGCGCCGACGTTCACGCTCGCTCTCTTTGGTCATGACTAGCAACTCAGTAATAGATGCATCTGGCGCT
TGAAGTCGTCTCAGCTCGTTCAGTATCATATTCTTGTCAGTCGGGGGGATTCTGCCGACTTGTGGAGTGCTGGTTTCTGGGTGCGAATTGCTTGTCCTCG
CAGTTGGTCGACTTGAAAACACGCGGCCGTGATGTAGATTCTGTTGCTGATTCATTCTGTTAGCGCTAATAGCAACCGGAAGCGAGGCGTGTTGCCTGGC
TCGAGTCTTGACGTTGATGACATCGTCACTCAGAATTCGGTTGTTGAGTGGGTTGAGAACGGAGAAGTCCATTGTGCAGGATTTTGCGGAGCCTTGTGCT
CTCGACACTGCAAAAGACGAAGTAGCGCTTGGTTTAGAACGCTCAGACAGTACCTGCTGATACAGCGTAATTGCGTGGGACCCGTAATCAAAGATTTGAC
CTATTTGGCGTCGCAATAATCTCGATTTTAGGGGTATTAATACAAGGTTATTGTGCTTTTCAACCTTTTTGCCGCACCCGAAACTCACATGGACCGGCGA
CAGGTTCAAGCGCGACGTGCAGATAGTCGTAGGCGCCGACAGCCTCATCCAACCCGTGCAACGCGCCGCCGACGCCGCCGCGTCCGTCCACGACCTCCCG
GGCTGCTCGCTGCTGCCCGGCATGGTGAACACGCGCACTTCCAGCGCTGACTGCGCGGCCTGGGCGAGACGTACCCCCAAGAACTCGGCGCAGATCAGCT
TCTGGACGTGGCGCTAGGAGATTTACAAACTCGTGGGCTGCGTGAGCAAACTGCAGATCTACGACTTGATAGGCCAGTGCTTTTCGGAGGTGCTCGACGC
CGGCGAGTTCCGCTACTTCCACCACGGCCGGCCGGATGAGGGCAAGAACGGACTTGTGTTCGTGTACGATGAGACGGTGCTGCGCGTAACCAAGGACGTG
GGCATCCGCATCGCGCTGCTGAACGCCTACTACGAGCATGGTTGCTTCCAGCGTTCGCCCATGGTGGAGTCCCAGATCTTCAATGGAGAAGCAACATCAG
TGTAA