Transcript Name :
Phyra_75402
Orientation:
(-)
Number of Exons:
2
Description :
protein kinase, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain49.743PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain3.3SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
KO ID
K08269
K08269
Cluster Id
4511
Sequence
        2749 bases(100 bases per row)
ATGTCGCGCGCGTCCATCGGCGACTACGTGGTGACCAGCAAGCTGGGCAGCGGCTCGTTCGCCGTGGTGTACAAGGGCTACCACAAGACGAGCAAGACGC
CCGTGGCCATCAAGGCGCTGTCGCTGCACAAGCTGAACCGCAAGCTGCTGGAGAACCTCGAGATGGAGATCGCCATCATGCGCCAGATCGACCACCCGAA
CGTAGTCAAGCTCTACGAGATCAAGAAGACGGACAAGCACATGTACCTCATCCTAGAGTACTGCGCCGGCGGAGACTTGCAGCAGTTTATGCGTCGTCGC
CAGCAGGAGAGCGGCGACAAGAGCCGCTTGCTGCGCGAGGACGTCGCCAGGCACTTCCTGCGCGAGCTGGCCAAGGGCATGCAGTGTCTCTGGCAGCACA
ACCTCATCCACAGAGACCTCAAGCCGCAGAACCTGCTGCTTGTAGAGGACTCACCCACTTCCGCGCTAAAAATCGGTACGCGCAATTATTTGTTTTTGAC
AATTATCGTATTCCGTGGGTTGACAATTATTGGATGCTTTGACAGCCGACTTTGGCTTTGCCAGGCATTTGGCCTCGACGTCCATGGCCGAGACCCTGTG
CGGTTCGCCGCTGTATATGGCACCGGAGATTCTAAGGTTCCAGAAGTACGACGCCAAGGCCGACCTTTGGTCCGTGGGCACGATCCTCTTCGAGATGCTG
GCAGGACGCCCGCCCTACGGCGGAGCCAACCACGTGCAGTTGCTGGCGAACATTGAACGCCAGCCGCTGCGATTCCCGCCGACACTGCAGCTCTCGAGAC
CCTGCCGACACCTGCTGGTGGCTTTGCTGCAACGGAAGCCGGCGCTTCGTCTCGGATTTGCCGAATTTTTCGCCGATCAATTTGTGGATCTGCAACCGTT
ACCCGAGCAAGCGGAGGATGCAGAAGCTACTCACCGCTCATCGACCCTCTCGACGACTGCTAGTATCCGAGAAGAGGAGGAAGAGGACGAACAGGGCCTG
CAACGAAGCATCAGAACAGGAGCAGGTGCGGAACACGATGTAGAAGCAGCAACTGCAGCAGCTTCGCCGGGCCCACGACGCGGATCTGGAGACCGTCGGT
CTCGAGCGTTCTCAGTTTCTCATGACTCAACGAGTTCGCGGTTTGCAAGCACGGCACCATCGGGAATGTTACGCCACTCGCGCAGCGGCAACCTGGAGGT
GATGGAGACTGCCTTTGCGAGCGCGAGCTCAGGTTCAGGAGCTTTACGTCGGTCGTCGTCGTCACGACTGGCACGAAGCCGGCGTGCTACGTCGAGTGGA
AGTGGCTTTGCACTAGGTGCTGCAGGAACGAGTCCGAAGCTCAGCCCTCAGATGAGCCCGCATGTGCTACCCAGTCCCAGCCCCAGCCCACGAATCAACC
CGTTCAAGCAGCTGTCAGAGTCGCCCCCTGGCGCCGCTGCACTTCAACAGCATTCGTTATCTGGATCATCTCGGATCAAGAACCCTTCAACTTCTCAATC
GGGAAGCAGCGATGCAATCGTGACAACGAGGCAGAAGATCTCTGGCGGTGGTGGCCCTGCTTTGGATAGCAGCGGCGAGTACGTGCTGGTAGACGGCCTG
CCGGAGAGACAACCTACACCTCTGACTGCTCGCTCCGACGTAGCCCACGAACCGACCAGTGGGGTGACGACCCACGATATGAAGATGAGAGCGTTGACTT
CCAACAGTGGAAATTCTGTTGAAACATTCTCTCGTGAGTACGGTCAACAACTGATCGACATTGTGGTTCTCCGTACTCAAGCCATCGCTCCAATTGCCGA
CCAGCTCTGGACGTTGAGCGCCGCTGGTGACGCAGTGCCGGGTTCTGAGACTGAGAATAATGGCGAACCAACGCGGGAGGACTGGTCACCACAGCAAACA
GTTGTGGAAACTTCAACACTGTCAACGTCCGGTGGCAAACGAGCTAGTGGCGTGAACTTCTCGTCTGTGTTTTCGATGAGTTCGTCGTTGGCGTCATCGG
TTGGTGTGAGCAATACGATTGGAGATGACGAATACGGCGATTTTGAAGACGATGACGAGGACAGTGACGACAAGCGCACTGCCGAACGGCAGTATGTGTG
TGCTGCTGAGGCGCTGGCGCTATACGTGAAGTGTCTTCGCTTGGTTCAGCATGTTGTTTTGTATTTGCGCCAAGATCCGGCGTTTGCCCAATCCCGAGGC
TCTATGGGATCATCGTCTGGATCATCATCAGGAGTGGCGCCTGGTTGGAGTGAAACAAACCGGAAGGTGTCGATGGCTTTCCTGTCGGAACAACTGACAC
ATTTCTTGGATCGTGCGGAGCAGTGCAAGGCGCGCATGGCCCGTGCTGCACGCCTTCAAACTTCGCCTCGACCCATCGCGTCGCAGGAAGAGCTTTTGTA
CGCTCACGCTCTTCGAATTGGTCGCCAGGGTGCTATTCGTGAAGTCTTGGGCCACACCCGCGCTGCACACGACCACTACCTGCAGGCCCTCCTCCTGTTA
GAGAGCTTACTTATGGATACACCTGGTGCACAAGGAGGCGCTGGCGCTGGTGCGCTAGCTGTGGATGACCAAAAGAATGTGAACACTTTCCTGCGCGCGC
TCGAACAGCGCTTGAAGAATGTTCGCTCGGTGCTCGAGGATGAAGAACACGCCGACACGAGTGCGAGCCACCGCCGCCGCGTGCAACACCCGCCTCGACC
TCCGCATCAACTCACCTACCGCCATTCTGCTACCGCAGCAGTGCTGTGA