Transcript Name :
Phyra_75398
Orientation:
(+)
Number of Exons:
3
Description :
abc transporter
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like16.56PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain2.2SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
Cluster Id
45
Sequence
        2157 bases(100 bases per row)
ATGACAGGACCCGTATGTTTTCGCGAATTGTGGGCGGTGCCTGACCCGCGTAGCGTCGTCCTCATCAGCGGCGGCGTTAGTGACGGTACCTCTCGGCCGT
GTGTGTCCCTGTTGCAGTCCTGCGGTGTCGAGCCCCCACCTGGAAAGGCTCGGCCCAGGAGACGGCCCGGGATTTGCACACTTTGCAATTCGCGGCGCCA
CCTCGACGCAGCCAGCCGGTGTCGTTCACAATCGAACTCGCGCAGTGGGAACGAGACCGCCTCCGCTCCTCCACCGGCAGCACCGCGCTAAGCTTGTGCT
TCTTCGTGTTGGACCCGGACCGAACTCCATCCATCTCTGTCATGGCGTCGCCGCACTCCACGCCCTACACGGCGCTCGACGCGCTCGAGACGGGAGGCAA
GACCGAACCGTCCTACCAGCACCTCACCAACCCGTGCGTGCTCAGCTGGAACAACCTCAGCTACTCTGTCGCCTGTCGCTCGACGGCCGACGCGCCTGCA
GGCAAGAAGGTCATCCTGGACAACGTCCGCGGCCGCTGCGCGCCTGGAGAACTCACGGCCATCATGGGCCCGTCCGGATCGGGCAAGACCACACTCGTGG
ACCTGCTGGCCGACCGCATCAGCTCCGGAGAAGTGACGGGCGACATCGAACTCAATGGTGAGGCCCGCGTGACCAAGACGTTCCGCGCCGTGACGAGCTA
CGTGGCCCAGGAGGACTCGCTGCTCGGGTCCTTCACGGTGCTCGAGACCATGCGCATGGCCGCCAAGCTCAGTCTGCCCACGAGCGTCTCGACGAGGCAG
ATCGAGGCCCGCGTGGACGACGTGGTGGAGGCCATGGGGCTGGCCACGTGCCGCCACACACTCGTGGGCGACATCTTCCGCAAGGGCCTCTCGGGCGGCC
AGAAGCGCCGTCTTAGCATCGCCATCGAGCTGCTGTCGAACCCGAGCATCCTCATCCTGGATGAGCCCACGAGCGGCCTGGACTCGAGCGCCACGCACAA
CGTCATGAAGTTCATCGTCAAGCTCTGCGCCGAGGGCAAAACCGTCGTGTGCACCATCCACCAGCCTTCGTCGCTGGTCTACGACATGTTCACCAACGTC
GTGGTGCTGTCGGCCGGCCAGACCGTCTACTGCGGCCCGCGCGGCCACGATGATCCCGCACTTTGCGTCGTCCGGCTACGATTGTCCTAACTACATGAAC
CCGGCCGAGTACTTCATCAGCCTCGTGAACACGGACTTCGACGACCACGCGGACGTGCCCAAGCTCGTGCAGGCCTACGCCCAGAGCGAGACCCGCAAGG
AGCTGAGCACGCGCATCGAGAGCGACCGCAAGACGCTGCAGCACCTGCCGGACATCGAGCAGCCGTCGCCCTCGTCTCTGCGGCAGTTCAAGGTGCTCAT
GTACCGCAACACGCTCAACAACATCCGCAACCCGGGCATCTACTGGATCCGCCTCTTCATGTACTTCTGCCTGAGCTTCATGGTGGGGACCATGTACCTG
AGCACGAACAACGAGCTGACGGAGGAGGACCTGGTGCCGCTGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCCGTGCTGCCCTTCTTCA
TCGAGCAGCGCGCCGTGTTCGCTCGCGAGCGCGCCAACAGCTCGCTGAGCGTCGTGAGCTACGTGTGCGCCAACTTCCTGGCGACGCTGCCGGGCATCTT
CGTGATCGCGGTCATGTCGACGGCGCTGGTGGTGCTGCTGGCGGGACTGAACGCGTTCGAGTACTTCCTGCTCAACCTCTTCCTGTCGCTCGTCGTGTCC
GAGTCCATGATGCACGTGATCGGGTCTGCGGTGCCGCACTACATCATCGGCATCGCGTTGGGCGCGGGCGTGTTCGGCATGTTCATGCTGTGCGAGGGCT
TCATGGTGCCTCGCGCCTCCATCCCGGACTACTGGATCTGGGGCTACTACCTGGCGTTCCACTCGTACTCGTTCGAGTCGTTCGTGTTCAAGCAGTTCGA
GAACGAGACGTCGGACGCTGCGAAGGCCATTCTGGCCAAGTACGGCATGGAGGACGTGGACGTTCCTCGCGACATGCTGTTGTTGGTCGTGTATATTGTT
GCGTTCCAGGCCATCTTTGCCTTCATCCTGTGGAAGTTCCACACGGGACGCCGTTAA