Transcript Name :
Phyra_75408
Orientation:
(+)
Number of Exons:
1
Description :
glycoside hydrolase, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Glucose/ribitol dehydrogenase6.9PR00081
Glucose/ribitol dehydrogenase6.9PR00081
Short-chain dehydrogenase/reductase SDR1.1PR00080
Glucose/ribitol dehydrogenase6.9PR00081
Short-chain dehydrogenase/reductase SDR1.1PR00080
Glucose/ribitol dehydrogenase6.9PR00081
Short-chain dehydrogenase/reductase SDR1.1PR00080
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glucose/ribitol dehydrogenaseIPR002347
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
metabolic processGO:0008152IEA
KO ID
K11153
*** None ***
Sequence
        1014 bases(100 bases per row)
ATGGGCAACCGCAGCAGCGCTATTAACACGACCGACACTCGTCCTCAGACTCCTGCCAACTGGAATGCCTCGGACATCTCGTCCCAGAAGGACAAGGTCG
CCATCGTCACGGGCGCCAACTCGGGTATCGGGTACGAGACAGCACTCGAACTCGCTCGCACAGGAGCCACCGTCGTTCTCGCCTGCCGCAACGAAACGAG
AGGCAAGGAGGCCGAGGCCAAGCTGCGTCAAGCGCTGGCCTCGACTGTCGACGCTGGCGTTGTTGAGTTCAAGATCCTGGACGTCAGTGACCTCGGCAGT
GTGAGCAAGTTCGTGGACGAGTTCAAGGCCACCCACAGTCGATTGGATCTGTTGGTCAACAATGCCGGCGTCATGGCGGTGCCCTACAGCAAGACGGTGG
ACGGTTATGAGCGTCAGTTCGCCACCAATCACTTGGGCCACTTCGCTCTGACGGCGCAGCTTTTTCCTCTTCTGAAGCAGAGCACGTCGTCTCGAATCGT
GAACGTGAGCAGTCTGGCCCACGCTGGTGCCAAGCTTGAGCGGTTCACGTCCGGATCGGAGATCATGCGCTCGAGCGATGAAGGCTACAAGCAGATGGAG
GTGTATTCCGAGTCGAAGATTTGCAATTTGCTCTTCACGTTCGAGTTAGACCGACGCCTCCGGGCTCGCAAGTTGTCGGGCGTGACTGCAGTGAGCTGCC
ATCCAGGCTTCACGGACAGCAATCTGGGAGTGGCACCCGCAGTTGAAAACACGGGCTTGACGGGGTTCCTGTGGCGCATCGGAGCGTACTTGCCGCTTGT
TCAGAGCGCTTCCAAGGGCGCCTTGCCCACACTGTACGCTGCCACAGCAGTGGACGTCGAGGGTGGAGACTACTACGGTCCCAATAACCGGTTTGAGATC
TGGGGCCCGCCGAAACGCGTTAATGCTAAGGATACTGCGCACGACAAGACTGCGGCGCAAAACCTGTGGAAAGAGAGCGAGCGCCTCGCCAAGCTCAATT
TTGACGTAGAGTGA