Transcript Name :
Phyra_75401
Orientation:
(-)
Number of Exons:
1
Description :
betacateninlike protein putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Hypoxia induced protein, domain16.153PS51503
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Hypoxia induced protein, domainIPR007667
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        600 bases(100 bases per row)
ATGCACAAGTCCGCACACGACTTCGACGAGGCCAAGCGCCACAAAGATGCCATCTCCAGGGACGCCTACGTCAGCGGCCTGAAGGCCGGCGCCTGGGCCA
GTCTGGCCATGGGCGCGGCCGTCTACGGCGCCAACGCGTACCACCGCGGCTTCCGCACACGCCTCGGCGTCAGCGGCAAGTGGGCGCTCGTGGTCTCGGC
CTACCTGGCCGGGTTCGCCATCGTGGCCGAGAACCGCCTGCTGGTTGGGGCCAGGAACCCCGAGCAGTACATGGCCTCGCTCGACCCGAGCTTCGTCGAA
GTCCGCAGGGTGACGAGCCACTTGCCCCTGCACAAACGAGCAGCCAACTTTGTGTACGATCACCCGTACCGCAGCTTGACCACCGTGGGGGTCCCTCTCG
TGGGCAGCATCTTCGCCTATCAGACCACGAACCACGGCATCAATCGCTCGCAGCAGATCATGCACACGCGCATCTACGGCCAGGCCGCCGTGGCGGTCCT
ACTGCTGGGCTCCATGGCCTTCCACGACTACATGGCCAAGCGCGGCCGCTTCGAGGAGGACGAGGACGACACGCCCAAGATCCAGGAGCTCACCGTCTAA