Transcript Name :
Phyra_71305
Orientation:
(-)
Number of Exons:
1
Description :
Translation elongation factor Tu putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Elongation factor, GTP-binding domain9.1PR00315
Elongation factor, GTP-binding domain9.1PR00315
Elongation factor, GTP-binding domain9.1PR00315
Elongation factor, GTP-binding domain9.1PR00315
Elongation factor, GTP-binding domain9.1PR00315
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
GTPase activityGO:0003924IEA
KO ID
K02358
*** None ***
Sequence
        1185 bases(100 bases per row)
ATGGCCACGTTCGACCGCACCAAGCCCCACCTGAACGTAGGCACGATCGGGCACGTGGACCACGGCAAGACGACGCTCACGGCCGCCATCACCAAGGTGC
TGTCCGAGACTGGCGGCGCCGAGTTCACGAGCTACGCCGACATTGACAAGGCTCCCGAGGAGCGCGCGCGTGGTATCACCATCTCCACGGCCCACGTAGA
GTACGAGACGGACAAGCGCCACTACGCGCACGTGGACTGCCCGGGCCACGCCGACTACGTCAAGAACATGATCACGGGCGCGGCCCAGATGGACGGCGGC
ATCCTCGTGGTCTCGGCCGGCGACGGCCCGATGCCGCAGACCCGCGAGCACATTCTGCTGGCCCGCCAGGTGGGCGTGCCGGCCCTCGTGGTCTTCATGA
ACAAGGTGGACCAGGTGGACGACGAGGAGCTGCTGGAGCTCGTGGAGATGGAGATCCGCGAGCTGCTCGAGGCCTACGACTTCCCGGCCGACGACATCCC
CGTCGTGCAGGGCTCGGCCCTGGCTGCCGTGGAAGGCCGCGACCATACCATTGGCCGCGACGCCGTCCTTAAGCTCATGGACGAGGTGGACGCTTACATC
CCGGACCCGGTCCGTGACTTCGAGAAGCCCTTCCTCATGCCCGTGGAGGACGTGTTCTCCATCTCGGGCCGTGGTACCGTCGTGTCGGGCCGCGTCGAGC
AGGGCGTGATTAACACCGGCGACGAGGTGGAGCTCGTGGGCCTCAAGGCTAGCTCCAAGACCACGTGCACGGGCGTCGAGATGTTCAAGAAGTCGCTGGA
CCGCGGCCAGGCCGGCGACAACGTCGGCCTGCTGCTGCGCGGCCTCAAGCGTGACGAGGTGCTGCGTGGCCAGGTGCTGTGCAAGCCCGGCACCATCAAC
CCGCACACCAAGTTCGAGGCTGAGGTGTACGTGCTCAAGAAGGAGGAGGGTGGCCGCCACACGCCGTTCTTCAGCAACTACCGGCCGCAGTTCTTCTTCC
GTACCGCCGACGTGACGGGCGACATCCAGCTCAAGGCCGGCACGGAGATGGTCATGCCTGGCGACAACACGGCCATCGACATTGAGCTCATCCACCCCAT
CGCGCTGGACAACGGCATGAAGTTCAGCATCCGCGAGGGCGGCCGCACCATCGGCGCTGGCGTCGTGTCCAAGGTCGAGTCGTAG