Transcript Name :
Albla_Nc14113720
Orientation:
(-)
Number of Exons:
1
Description :
ATPbinding Cassette (ABC) Superfamily putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like18.908PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain2.3SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
493-503
572-577
627-632
705-708
1-469
527-548
601-603
656-681
470-492
504-526
549-571
578-600
604-626
633-655
682-704
*** None ***
*** None ***
TypeScore
endoplasmic reticulum444
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
Cluster Id
45
Sequence
        2127 bases(100 bases per row)
ATGCAACAAAAGTCGCCCATTGAGTGCATCATGCAAAGTCCAGCGAGGTATCACAGCATTCAACACGGGAACAACTCACCAAAGTCAGAGACACAATCCA
CCAGCAATCGAGGCAAACCTAGCTCTATATTTCACGGCGCACAGTATCCCGAGTCGTCTGCTAGCGATCATCAGAGCCAAAACTCCTCGGCTACACACTA
CCGGAACATCCACGAGTCCTCACAACACACGGAAGATATCATTATTTCTACGATCGCTTCTGTGCCCGACAATGGACACGGAAACTCGCTATCGTTAGGA
CTTTTGGATATCAGTAAACAGCTCAGAAACATCAATTACTGCACGTTGGCGTGGCAGAATCTCTCGTATACGATTCGAGGATCCAATACTTTCTGCTTTA
AAAAGACCAAAAAGACCCCTCCGATGGATCTGCCGATGAAAGCACTGACAGAGAAATCGTCTCGCTGCATCCTGCGAGGGATCACAGGTCGTTCCGCACC
AGGAGAGCTGACTGCCATTATTGGTCCCTCTGGTGCTGGAAAGACTACGCTTTTGGATCTGTTGGCAAATCGTATTGACCCGAGTACTGGACATATTGAG
GGCGTCATTGAAGTAAATGGACAAGCTCGAGAGGAGAAGTCGTATCGAATTGTCACCAGTTATGTGTCTCCAAACATGTCGTTTTATGGGTCCTTTACTG
TTCTTGAAACACTGCGTATTGCTGCCGCATTGAGTTTACCAACACATATTCCAAAACTCGCGCGGGAGATACGTGTCCAGGAAGTCATCGATAGTATGGG
ACTCCGAAACTGCTCTGGAACACAAGTCGGTGATCTCTTTCACAAAGGGATTTCTAATGGTCAGAGAAAACGTCTTAGTATCGCAGTGGAATTACTCTCG
AATCCGTCCATTCTTTTACTGGATGAACCGACCTCAGGCTTGGATTCTTCCTCGGCTTTCAACGTTGTTCAGCACTTGTCCAACCTCTGCAAAGATGGAA
AGACAGTTGTGGTCACTATCCACCAGCCTTCGTCTTCGATCTACGAGTTCTTGACCAATCTCATGATTCTCAGCTCTGGCGAAATGGTTTACTTTGGCTC
CGGTACCAATGCGATCAACCACTTTACATCCATTGGGTATCAATGCCCGACCTATTCGAATCCTGCGGAATATTTCGTTCAACTGGTCAACAAAGATTTC
GTGGATGATTTACATATTGAGCCATTCGTCGACAAGTGGCGGACAAGCAACGACGCACTACGACTACATTCAACAATTATCCACGATCGAGAGCATGGTG
CGTATGGGATCGATCCGGATCTTGTACGAGCTTGGCATCCTTCGCCGTACTTACAATTTCGGGTCTTGTGTTACCGCAATTATATCAATACGGTCCGAAA
CCCCGCGGTTGTATGGATTCGGGTGCTGATGTATTTATTGCTCTGTTTGATGATCGGAACGATGTACCTGAGTTCCAATCGCAAGCTCAATGAAGAACAG
ATTGTGCCTCTGCTCTTCTACGTTCAGGCGTTTTTGGTATTCATGTCCATCGCTGCTATTCCATCTTTCATTGAGGCTCGAGCTGTCTTTGTGCGAGAAC
GAACAAATCATTCCATCAATTTGATAAGTTATGTCGCTGCCAATTTCGTGGCATCCATTCCCGGGATCATCATCATCACATTACTGGCATCCATTATTAT
CGTTCATTTCGCATCCATCCACACGTTCAAGTCCTTTTTCATCAACCTTTTCTTATCGCTGGTCACTGCAGAATCGTTCATGCATGTGCTGGGAGCCGCA
GTACCTCACTATATCATTGGGATCGCGCTTGGAGCAGGTGTCTTTGGAATGTTTATGCTTTGTGAGGGCTTTATGGTCCCTCGTGACGCGATACCTCTAT
ACTGGCGATGGGGATACTATGCCGCCTTCCACACATACTCTTTCGAGTCATTCATGTACAGTCACTTTTCGGTGGTCAACACGGACGTATCTTGGAATAT
TTTAGCGCAGTACGGAATGTCGGACGTTAACGTGGGAAACAATATGGTCATTCTCGCTGTCTATGCGCTGGGGCTTCAGATTATATTCACGTGTTTGCTC
TATTTCAAATACCATCGACGGCAGTGA