/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_2f58dc7ab713ab31e08b9cbef44fcc56 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/890382 -w 120 -web -o /tmp/images/bd_log_output_file_2f58dc7ab713ab31e08b9cbef44fcc56
Transcript Name :
Albla_Nc14000420
Orientation:
(-)
Number of Exons:
4
Description :
enoyl putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Glucose/ribitol dehydrogenase1.1PR00081
Glucose/ribitol dehydrogenase1.1PR00081
Glucose/ribitol dehydrogenase1.1PR00081
Glucose/ribitol dehydrogenase1.1PR00081
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glucose/ribitol dehydrogenaseIPR002347
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K00208
K00208
K00208
*** None ***
Sequence
        982 bases(100 bases per row)
ATGTATTCGCTGCATGGAAAACGAGCGCTTGTGATCGGAATCCGCAATAAATATTCAATCGCGACGCAAACTGCGCTGTCGTTTCTTTCACTCGGAGCGG
ATGTGATCGGCGTCTCTAAAGAGCCTTTGTCCTTCACTGCAATGGAAGCGTGTGGTCTGCACAAGCAGGCGCTTAAATTCAAGCTTCTTTCGTGTGATCT
CACGGATGAATTCGCGTTAGAAGAGCTTTTGCGCTCGTGTGGACAGCATTTTCATGGAGGAATCGATACTATCGTACATTCTGTAGCATTTGCATCACCA
GAGGCTTTCATTCCCATCCAAAAAGACTCTCAAACTCCTTCCGGCGGACTTTTACAAACATCCAAAGCACATTGGCAGCAAGCACAGGATATCAGTGCGT
ACAGTTTGGTGGCGTTGACGCAAAAAGCACTTCCACTACTCACAAAAGGCAGCATAAATGCAGATAAAAGTATCATTGCGTTCTCATTTGAGGGAGCAAA
CAAGGTGCATAGTAGCAAGTCTCAGAGCCAAGAAGCATTCCTTCCGCGAGTTTGTAGGTCGTTCCAAGCTACAATGTGATGGGACCCGCAAAAGCCGCCC
TGGAAGCTGTTTCAAGGCAGTTGGCTGTGGAACTGGGTGGGCACAATATCCGTGTCAATTGCGTCAGTCCCGGACCGATTAATACAGCTTCAGCTCGAGG
AATTCCCGGCTTCTCGGTAGGTTGCTTCGGTGAGTAGCAGTTTGATCATCAATACTCTGTAGACAATGCGTCAATTTGCACAAGAACAAGCGCCGCTGAA
ACGAAATGCGACCGCATTGGATATTGCAAATCTTGCGTCGTTTTTGGCGAGTGAAGCGGCTTCATGCATCACCGGGCAGACGATCAAAGGTTGGCATATA
GTATTAGATGAACATCTTGTTTCTGAGGCTACACACTGTAGTGGATGGAGGAATGAGCGCTCTGTCGTCATACAACTTGTGA