Transcript Name :
Phyra_72572
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.6161.4120.003
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1392 bases(100 bases per row)
ATGCCGCCCAAACAGCGTGTCCGCCAGCGCTTCGGCCCCAACCAGGACTACCTGCTGGTCGTGCAGGTGAACACGGACATGCCGTTTCGGGCGCCCTACG
GCGGGCTTATGGCCGGCTGGGAGAAGGTCGCCAACACGCTCAACGGTTGCAGCGCCTTCAAGATGCACCATCTCAAGGGTCCTATCGCCAAGAACCGCTT
CGAGCGTCTCGTGGGGCGCTACCGCAACTGGGTCAAGAACGGCAGCCACCCGGATGACGCCCCGTCGCAGGACGCTTCGTTCCAGAGCATCATGGCTGAG
GTGGTGCCCAAGCTGGAAGCTGCTGAGGCCGAGCCACAGATCCACACGTTGGGCAAGCGCGGCCGCCCCAGAAAAATCCGTGCGGAGGATGGGCTGCCCC
CTGCGGAGAAGAAGGCGATGCTGCCGCCGTCCCAGGTGACCATCGCTCCGTCCCCAGTGGGGCCGCAGCCTTCGTCGTCCACGTCTCTCCTCGTGGATTC
CGAGGATCAAGCGCTGCCCATTGTCATCAAGCCCACCCGTCAACGGTTCACGCCTGGAGACGACCTCCTCCTCGTCAGCTACGTCAAGGAGACACTGCCG
TTCCGTGCCAAGTTTGGCGCGATCTCGACAGCGTGGGAGGATGTGGCGACCAAACTTGACAACAGCCCGGCGTTCTCCAAGCACCACATCAAAGGCCCTA
TTGTACGCTACCGATTCGAGAACCTCGTGTCCAAGTACCGCGAGCGCGTCAAGCGCAACAACGGACGTGTGGTGGGGCCGAAGGGGGCTCCTGCAGGTGA
ACTTGAAGTTCTCATGACGGAGTTGGTCACGCTGCTCGACGGTGGGGACCCCGTCAGTGCAGCTTTGCTTGCGCAGAACGTGGCGATCGCCACTGGGGCG
GTCAGTACTGTAGAAGAACGAAAAATTACTCGCCCTACAACGAGCCAGGATGAGGATTCTACCAGTAGTACGAGTGAGCCGTCATCGCCGGCCCGCATTC
GCTCCGAAGTCGCCTCATCCGCAATCCAGAGCTTTATCACGCCTACGTCTGAGCCCGAGCCGGCACTTCCACCAGCGTCAGCGACTTCGTCGGCGACGGT
TACTGCGCCAACATCTATGAACCCGGTGACGATCGCTTCGGTCCTGAATAAGACGGACCCTACGAATATTGCTGAGCTCAAGGCCCTGCTCCAAGAAATG
GTGGAGCAGCAAACTCGGAGTACCGAGCAGATGCTGTTGCTGCAGCGTGAAGAACGCCGCCTGGAGGCGGAGCGGCGAGAGCGAGAGCGAGAGCTTGAGC
GTGAGGAGCGCGAGAAAGACCGCCAAGCGCTGACTGCCACGGTGATGTCGGTCATGACGACGTTCCTCGAGCAGAGCGGCCGTAAGAACTGA