Transcript Name :
Phyra_72579
Orientation:
(+)
Number of Exons:
2
Description :
general transcription factor IIH subunit, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K03143
K03143
K03143
Cluster Id
4851
Sequence
        979 bases(100 bases per row)
ATGGCGAGCGCGTCAATGCAGGCGAATGGGACGGCCAACAACGAGGTGGCCACCGAAGGGCTGCTGGTGCTGGTGGTGGACACAAGTCCAGTGCACTGGT
TCGCACAGGGCGGCGGAGCGGCCGACCGCGCTGGGCTACAGCAGCTGATCTCCAGCACGCTCGTGTTCGTGAACTCGTACCTGCTGCTGCACCGCAGCAA
CCGCATTGTGATCATCGCGGCCCACGCCGGCAAGAGCGCGATGCTGTATCCAGATCCAGAGCAGGAGGACACGTCCGGTAACGCAGAGCAGGCGGCTAAA
GTCAACGCTGGCGTCATGCAGCGTCTGCAGCAGCTGAGTGACGCACCGCTGGACCCAGCTAAACCCAACCGAACGGCCATCGCAGCGTCAATATCACGCG
CACTGTGCTGTAAGTTTCCTGCACTGTTAAAAGAAGGGTATTGTTTGAGAGTACAAATGATGTATCGGCTTGTTGTTGTGGATGGATGCAGTTATTAATC
GTGCAATCAACGAGGAGCCGGACCTGCGCCCACGGATCTTGGTCGTCCAGAAGTCTCCCGACGTGTCGGAGCACTACATCGCCATCATGAACGGCATCTT
TTCGGCGCAGAAGAAGAGCGTGGCGGTGGACGCCTGCATCCTCGCGGCGGAGCACTCGTCCTTCATGCAGCAGGCTGCGTACCTTACCGGTGGCATCTAC
TACAAGCCCAACGGCCCCAGCGGGTTGCTGCAGTACCTCATCTCGATCTACTTACCGGATCCATCCATGCGCAAGTTGTTGAAGCTGCCGTCGCAAGACT
CGGTGGATTTCCGCGCGATGTGTTTCTGCCACCGCGAGGTGATTTCCACGGCGTACGTTTGCCCCGTGTGTCTCTCGCTGTTCTGCGAGTTCCGACCCAT
TTGCTCCACCTGCGGCATCCGCAGCCACATTCAGCCCAAAAAGAACGGCGTACTCAAGAAACGCCCGCGCGTAGCTTAA