Transcript Name :
Phyra_72559
Orientation:
(-)
Number of Exons:
1
Description :
gag protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type9.949PS50158
HmmSmart predictionP-Valprediction_id
Zinc finger, CCHC-type0.0011SM00343
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        966 bases(100 bases per row)
ATGGAACGAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGT
CGGTGACGCCAGCCGAGCAAGTCAAACGCGTGAACGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGGGAAACCTGCAGGCCTCTGTGGC
CGAGCCGAAGCCGGTCCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGTGAAGGAAGGTGAAAACCTTCACTTCTGGATCCGAGAAGTTGAG
ATCGCCATGGGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTATCCAACCTAAGCGGTCGTGCCAAGAATTGGGCGTACACGCTGG
AGACGACGTCTCCTGGATGCTTTGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGACGCGTTCCGCCAGCGCTCACG
CTTCCTTGCCTGTAAGCAAGGGAAGCGCGAACTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGAT
GTCAAGACGACGGTCTTCACGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGTTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGATCG
CCCTCCAGGAGGAGTACAGCCATAAGCAGGCTGGTACTCCGGTTGTTGCGCAACTTGTCGTCGCGAACAACGAGCCAGAGCCTATGGACTTGAGCTCTGC
TGAGCTTGGCTTGGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCC
CGAGGGCCTAACGGTCGCTGGCGCAAGCCGCGACCAGGTGGCCGAGGGAACTCCGGCCACCAGTAA