Transcript Name :
Phyra_93238
Orientation:
(+)
Number of Exons:
2
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pentatricopeptide repeat8.342PS51375
Pentatricopeptide repeat11.477PS51375
Pentatricopeptide repeat5.842PS51375
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pentatricopeptide repeatIPR002885
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        886 bases(100 bases per row)
ATGATGCAGGTGATGGCGTTACGCCGTGCGCTGTTGGGTCGGACGCGCAGCGACCCGTTCGTCTATGCAGTGTCTGCTATATCTAGAGACGTATATATTC
CACTTGCAGGACTTCGTGCTCGCCAATTCGTTGTATTAACGTCGAACGACCGAGAAGTATCTCCCCAAACGACGCTACAGCGCCTCACGGACGCCTCCAA
ACTCTCGTGGAGACTACGCGCCGCTGTGAAGGACGTGGAGCAGTCGCTACCTGCTGATAAAGGCAAGAGGTTCTATAATCGACGGCTGGTAGAGGCGCTG
GAGAAGAGCGACTACAATCGCGCTTGGGCCATAGTGGAGACGCTGCACCGACGTCATCCGGACAAGGCCGTACTATGGCCGTATACGTACAATTTGCTGC
TGCGCCACCTTTGCAAGCAGCAGAAGACGTTGATGAACGCCAACTTGACGCGCATTCTGGCGCTACTGGACATCATGGTGGATTACAGCTGCGCAAGCCA
GACGAGCTTCCAAGTGGCGATGGCTGCGTGCAGTCGCGCGCGGTATCTACGCGGCGCGAGGCATGTACTGGGGAAAATGGAGGAGTGTGGAGCGAAGCCT
GATGCAAGGATCTATGGCTTCCTGATTAATTGTTGTGCTCGGAAGCGAGGCCTGGTGAAAACTGCCGAGCAGTATTTTGACGAAATGCTACGTGAAGGGG
TGAAGCCAACGACCTTAGTAGTGAATGCGATGCTACGGGTATATGCACGCGATACTGGACGGTCGAAGGTGATGCTTGAACTTGTGAAGCGGTCTGGTGA
TGAGTTTGGAGAAGTTCCGGATACTGTGACAACGCGGACACTGGTGCATTATCTTTTGAGTGATGGTGCTGTGAATGACGCAGTGA