Transcript Name :
Phyra_38878
Orientation:
(-)
Number of Exons:
1
Description :
DNA repair and recombination protein RAD54
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain19.764PS51192
Helicase, C-terminal15.289PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1.9SM00487
Helicase, C-terminal1.6SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
KO ID
K10875
Cluster Id
2653
Sequence
        1707 bases(100 bases per row)
GTTGTGGATGCACCGCCGCCTCTTGTGCTGTGGCAAAGTGAGACGGACCCAGAGATGAAAGTGGTGGTGCCCGAGATCGTGGGCAAGTTCCTGCGTCCTC
ATCAGCGTGAAGGTGTGCAGTTCATGTTCGACTGTGTATGCCAAGTACGAGGCTTCGACGGACAAGGTTGCATCTTGGCTGATGATATGGGCCTGGGAAA
GACCTTGCAGAGCATCGCGCTGATGTACACGCTGCAGATGACGGGGATGAACATGCAGCCGACGGTAAAGCGAACAATTGTGGTATGTCCTACGTCGTTG
GTGAAGAACTGGGACGATGAAATTATCAAGTGGCTGCACGGTCGTGTGAAGACGGTGGCGCTGTTTGAGGCCAAGCGCGAGACGGTGATCAAAGGCATCA
ACCAGTTTATCGAGGGAAGCAAGAGGCCTAGACCAGGGTTTTCTGCTCAGGTGCTTATCATCTCGTACGAAACGTTCCGCATGCACGTGCAGAAATTTGC
AGATACACCCGCTTGCTGCGATTTGCTAATTTGTGACGAAGCCCATCGACTGAAGAACGCCAACTCGCAGATCAACAAGGCGCTATCGTCGCTGGCGTGC
AGAAAGCGAGTGCTTCTATCTGGTACACCGATGCAAAACGATCTGGATGAGTTTTTCGCTATGGTGGATTTCACCAACCCGAATATCCTCGGCACGCCAA
GTGAGTTCCGAAAGAATTATCTTGGCCCGATCTTGATTGGTCGAGAACCGGACTCGACGGATCGTGAACGTGGCGTGGCGCAGTCGTGCTCAGCAATGCT
TTGCGAAATTGTGAATCAGTTCATTTTGCGCAGAGGTAACATCTTAAACGCCAAGCATTTGCCACCAAAGTTGATGCAGGTAGTTTGCTGTCCGCTGTCT
CCACTGCAGGAGCAGCTCTACATGCATTTTCTGTCGTCCAATGCCTGTCGGGATATGATGAAGCGCAAGAGCGTGAACGTTTTATCGTCAATTACGGCAC
TGAAGAAGCTGTGCAACCACCCACTACTGATTTTCGACGAAATGGGTAAAACCAACACGAAATTGCCTGGTTTTGGCGACTGCGCACAATATTTTGTGGC
AGCTAAGGAGTCCCGAGAGAGTGGTGGTGATGATGGTCGGCATCGACGAGGGGGCTTTGGTGGACGCACATGCTACCCAGAGTGGTCGGGTAAGATGCTT
TTGCTGGACCGTTTGATGCTTTCGATGAGGAAAACAACAACGGACCGAATTGTGATCGTGTCCAACTACACACAAACGTTGGATGTCGTGTCTAGCCTAT
GTCAAGAACGGCATTTGCCCTTTGTTCGCCTGGACGGAACGACATCTGCCAAGAAACGAAAGAAACTGGTCGACACTTTCAATGATCCAACGACAAATTC
GTTTGCTTTCTTGCTTTCGAGCAAAGCTGGCGGGTGTGGTTTGAACTTGATTGGTGCAAACCGCTTGGTACTATTTGACCCTGATTGGAATCCTGCGACA
GACAAGCAAGCTGCTGCTCGAGTGTGGCGTGAAGGTCAAAAGAAGATGTGCTACGTGTACCGTTTCCTGGCGACGGGGACACTCGAAGAGAAAATCTTTC
AGCGCCAGCTGTCCAAGGAGGGTCTTCAAAATATCGTTGATGATAAAGAAGAGGTGAATTCACTGTCCTCAAAGGATTTAAAGCGGCTATTCGTGTTTCG
GAAAGAC