Transcript Name :
Phyra_72587
Orientation:
(+)
Number of Exons:
2
Description :
PREDICTED: peptidyl-prolyl cis-trans isomerase-like 6-like
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cyclophilin-like peptidyl-prolyl cis-trans isomerase domain15.19PS50072
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.5331.1750.002
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein foldingGO:0006457IEA
*** None ***
*** None ***
Sequence
        871 bases(100 bases per row)
ATGGCGACGACAGGCGGGGCTGTAATGGAGTGCTGCGAGCTGGTGGGTCTCATGGGTGACGTGGCTTACCAGCGTTGTAGATTGCTGCTCCATGAGCTGC
GGAAGCTGCACCCAATCTTCGTGTCTCCGCTGGAAGGGATGATGGAGATTGAATACCTGGAGTATTTGCAAAACCAGCAGGAGAAAATCCCCAAGAGCGG
GCGTGCAGAGCTGCTTCGAACGACTCGACCAATCATACTGTTGTTGGATTCCTCAAACGACATGCTAGACGGCGAAGACGACTTGCTCGACTTCGCAATG
GAACGGACACAACTCTCGAGGAATGAATTGCTAGCCGCTGCAGCGTTTGATGGGATGCCCGTGCTCGGCAATGATAGCGATGGCAGTGACAGCGCACGGA
AAGAGTATAACGAGAAATTGGCACTCGCGGAAGAAACGCTGGAGGCAAAAGCGGAGGAAGCAGCCCAACAAGCTCTGGCTCATTATCGCGAGTCGTCTGG
ACATCAGTATGCTTTTCTGGTCTTCGAAGTTGATGGTGTGGCGCTGCCGCGGGTAGAACTTGAGCTCTACCAGGACGTGTGCCCCAAAACATGTAAAAAC
TTTCTGGCGTTCTGTGAGCACAAGGTCCCTGACATCAACGATGAAACACAACAGTTAGGCTTCCAGGACAACCCGGTGCACCGCGTTGTACGTGGCGGCT
GGATCCAAGCTGGTGATGTGGCTGGTAATGGTCGAGGAGACGGGCCTCCTCGGTCTCTTTACGGCCTCGAGTTTGGTGATGAGAGCTTCGCTATCTCGCA
TAGCGCTGCTGGCATCCTTGTACGTCCGTACCTACAAACTAACCTTCGTCCATCAGTCACAAATGGTCTAA