Transcript Name :
Phyra_72568
Orientation:
(+)
Number of Exons:
5
Description :
RING zinc finger-like protein
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type11.545PS50089
HmmSmart predictionP-Valprediction_id
Prolyl 4-hydroxylase, alpha subunit0.0052SM00702
Zinc finger, RING-type0.0069SM00184
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6050.58936
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
iron ion bindingGO:0005506IEA
oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygenGO:0016705IEA
*** None ***
Cluster Id
192
Sequence
        3526 bases(100 bases per row)
ATGGCCAAGACGACGAATGCTGCGCCAACCATCAAGCGCTTGCCGCTGTCGAGGAATTGGGTGGCGCTGGCCGTGATCCCCGCGATCGTGGCGCTAGTCG
CTGCCGTCTGGACGCCGCCCGATTGGCTGCAGCACCGCCTCGTCGACTTGATCGGATCCGCGGAGCCTGCGGCTGCTGCGAATGCCACTGCGCCGCCCCC
TGCTGATGAGCTGCTCGTGGACAAGTATGAGAGTGAAGTGGTGACGATTGACACGCACCCGCTGCTGGTCGGGGCGCAGCTCGAGTGCCCGGACGTCCGG
CCGACGGGCGAGGGTTTGACGCATGTGGAGCTGGTGCTGGGCCAGAAGCAGCAACTCCAAGCACAGGACCGAGTCTTCTTCATGCTCAACGGGCAAAACG
AAGGGATCTTCTTGCCCTGGATTTACCGTCAGGACGAGGACGCATGCCTCCTGGAGCTGGCGCAGATGGCGGCAGAGCACCTTGGAGCCGATCCTGATCG
AATGGCCAATGGAATGAAGCTCTTCTCCATTGACGGCTTGCCAATCCTCACGGCGCACGAGCTGAACACGCAACGTATTGCTCACGTACTGCTAGATGGA
CAGCTCTGGGTGTGGCCTGGAGTCAAGGTGGGTTATGTTCGTGAGATCGAAGGCTGCACCGTCACGACGCAGTCACTTCATCCGAAGGTGTTCACGGTGG
AAGGCTTCTTCTCGCAGGAGGAAGCCGATGCCATTATTGCAGAGGGTGTCGATCATCTAGCCCGCTCTCCCGTGGACAGTGTTGATGCAGAGGATGGCTA
CCACGCGGACCGCACGAGCTTCACCGCTTTTCTTGATGATACTCAGTTTACGCGCAACTTCCGTGTACGATCGGCGCGGATCGCCCGCCTTCCGTCTCCT
AGCTACACCGAAAGGATGCAACTCGTGAGGTACGAAACGGGTCAGTTCTTCCGCCAGCACGAAGACTATTTTGACTCGAAAGTGTTTCTGCGGAGCAAGC
AGTTGACTGCGGACGAGTTTGAGGCATGGATCGACTGGGCCGCAGTCAAAATCGAGGAGCTTCGTCAAGAGCATGGAGACAACGTTATCCCTGTTGAGTT
CTTACCTGGTGGCGTAATGTTTCCGGATGCCCAGAGCACGACAATATTCCATCACGCACTTCTGACAGGCTTCATGGAGGACGCGGGCGCAACCAACTTC
TTCTGGGAGCACGCTGATGTGGAGTGGGAAGCATGGATCAACGAGAACCTTAAACGTGAAGCGGACAACATCATGGGGCCGATTTTGGAGAGCAAAGGCT
ATATGTTACCGTTCATCGTGAAATCATGGGAGCATCGCGCAGGGCTTCCTGAACTTGTGTATTCTTTTCCAAAACTCCCAGTTAGTGCCATCTCGCACTA
CTTTCGGTGGGTGCGTTGGGCGAAGGAGCGTGTACAGACGCTACTGGACACGCAGGCAGATACTGTTCCGAAGCCTGTGAGACCCGAGGGAGAAGACTAT
CCAACATTTTACATGAGTTTTCAGAGCCGCCTGGTTGGCTATATCCTTGAAGACTACAGTGAAGAGCTCCTTGTCGAGGTACTAACTGCGGAACTGCACA
TGTGGCTTGTCGAGAACCAAGACAACAACGATGCTCTGCTCGAGGTGCTGCGCAATAGCCCGCGTGCTTTCGACCTTGTGGTGGAGGCTTGGACCAAGCG
CGCTGGCAGCCTATTCGCGTATGAGAAGCCGACGTACCTGCACCACTTCGAACCGAATCGGTTCGCAACGCTGTTCCTCTACCTGAATGACTGCCCTGAA
GGTGGCGAGACAGTGTTCCCGTACTCGAAAGAGCGTGTGGTGACTGGAATCGAGCGGGAGGGTATGGACGAATGCTCCGAGGGGCTCGCAGTGCCACCCG
TGAAGCTCACTGCGTCCTTCTTTTACTCGCAGACACCAATGAACGGGCTGGATCCTGCCAGCCTGCACGGCGGCTGCCCTCCGGCGAAAGGCTTGAAGTG
TACGTTGTCAGAGCACTTCAACCAGGCACTTCAACTAACGAATTTTACGCTTCTGTAGATGGAGCCAACTCATTCATGTGGAATGCCGACGCCGACGAGG
GCGCTAATATATGGGGCATGGGCGAAGACTTTAAAGAGGAGATCAACGGAAAGAAGCAATCAAGGGGGTGAGCCGCTTCCTCAGCATCGTGTAGCTTGGG
AGATAGATGATGTGTATGACAGTAATATAATATTCTAAGTATAAAAAACGACCGTCCAGCATTCACCATGGGCCATACAGCCAGCGTCAATCGGCAGCGG
CGCAGCACGACAGGGACGCTGTATGGGGAGCCCGCAGGCGCGGCAGCAGCTCCGCGCGGGAGCTACACACCGGCGCAGATGCAGGCGCTGTACCTGAGTC
GAGGTCGCCCGGACATGGCCTTCATGTCCAACCAGGGACGTGTCCCTGTGGACGTCCCAGAGCTACAGCAAACGTGCACTGTGAAGAACCACGTGAACCT
CAAGAAGGCCAGTCTCAAGCTGCAGCAGTCGCCCACTCACCCGCAACAATACGCACTGGAATTCCAGTTCGACGCCACTAAACCGTGTCGGATAAGCGTC
TTCTTAGTGGCTGCAGAGACTGTTGATGCGGACACTGGCAGCTCCAGTTTTGCCCTTGTTCACGAAGACAAGAACCCTGTACTGGTTGAGCACTTTCCCT
CTGGATTGGGCCAGAGCTTCTCTCTGAACGGGATCGAGGCTGAAGAGGAGGTGGCCAAGGAAGAGGACCAAGAGAAGCACGGCCCACCACTGCCGCTATT
GGACTTATCGACGTATAATCCTGATGAAATGGTGTACAAGACTGGCACGATGCAGTATCCATTGATCATCGTGCTGGAAGTCTCTTCAACCAGTATGTGG
GCAATCTGCAACGACTTGACATGCTCGGATGTTGTTACTCATGGCCTGCTGATACTTCGTATTCTTTAGGAAAAAGCCCGCAGTCCCAGTCGACGTTCTG
CACGTTTGTGAAGAAAGGTGAAGACTGCTGGGATATCAAGATGCTCAAGCAAAAAATCCTGGTACGGAATGGGTAGTCATCTACATTGCCGGCTTGCAGT
TTGCCAAGCCTCAGAGTGTTCTCACGCTTTCTGCGTCGTTTATTGGTCGACTAGGTGGACGGACTGACATATGAGTTGCAGGAGATCTACGGCATCGATG
GGTCAGTGGCTGCAGCACCCAAGGCCGGAGGTGCTGCTGGAGGAGGACAGGCTGACACAAATCATGCTACGAAGGATGAGATCGAGATTCCGGAAGGTGC
CGAGTGCATTATCTGCTTGTGCGAACCTCGCAACACGACAATTCTACCCTGCCGACACATGTGCCTCTGCAGCGAGTGCGCCGAAGCGCTGCGAAAGAGC
TCCAGTACGTGCCCCATATGCCGCACGAACGTTGAAGCGTTGCTGCAGATTCGAGTCGAAGCTAAAGAGACTACGACGACAGAAGCAGAGGACGATGCCA
AGACAGAAGTTGAGGATTCAAAGTAA