Transcript Name :
Phyra_38871
Orientation:
(+)
Number of Exons:
2
Description :
ABC transporter lipid export ABCA family
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like18.541PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain3.4SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
Cluster Id
26
Sequence
        1227 bases(100 bases per row)
ATGCAGATCCTGGACACTCTGCTTTATTTTCTACTTGGAAAGTACTTCGAGAAAGTGGTTCCGCAAGAGTTTGGTGTTGCGGAGAAATGGTATTTTTTCT
TCACGAAGGTGTATTGGTTCCCACAGGCTTCTAAGCTTGTGTCAGCCGAAACACTACCAGACGAGGAACTAGGAGATATCTCAAAGGAGGGCGACACGGT
GGAGGCGGTTGGTCTTGACCTTAAAGAGCAAGAAAAAAATGGTCGTGCTGTAGTTATTGCGGGCTTGCGAAAGGAATTTTCAGTTCCCGGGGGCACGAAG
ATTGCGGTTGATGGGCTGCGGTTAAAGCTCTACGAAGGTCAAATCACGTGCTTGCTTGGTCATAATGGTGCAGGGAAAACAACGGTAATGTCTATGCTAA
CAGGAATGACGGCACCATCAAATGGAAATGCTTGGGTTCGTGGCTATTCCATCGTCACCGATATGAGGTTCATCCGCCACTCTCTTGGCTACTGCCCTCA
GCATAGTGTGTTGTATCCAGACTTGACTGTGAAGGAACACTTGATCTTTTACGGGCGCCTGAAGGGAATCACTGACAGGAGCGAACTAGCGATGGAGGTG
ACGAGGAAAATCAACGAAGTCGGCTTGAAGGATAAGAGCCACGTGCAATCGCATGCTTTGTCAGGGGGAATGCAGCGCAAACTATCACTCGCGATAGCCT
TCTTGGGTGATAGTTCAGTGGTCTTCCTGGATGAACCAACTGCAGGAATGGACCCGTACAGCCGACGCAGCACATGGGAGCTTATTCAGCGCAATCGCGC
TGATCGCGTACTGATTTTGACGACTCACTTCATGGATGAGGCAGACATTCTAGGTGATCGGATTGCCATTATGGCGGAAGGGAAGCTTCGCTGTGTCGGG
TCATCGTTGTTCTTGAAAAAGCGTTTTGGTGTTGGCTATCGTTTGAGTTTTGTACGACAGAGTAGTGGTGCTTTAGGCACGACTGTCACTTTACACTCTG
AATCCGTCACCTTGTTAGTTCAACAGCACGTGGCTCAAGCGCTTGTTGCGTCAGATATTGGAACGGAGTTCACCTTTCAGCTGCCATTCGAGGCATCTGC
TAGTTTTCCAGCTTTGTTCCGAGAGCTGGAGGCTCGCCAAAGTGATCTTGGTATTATTTCGTTCGCCATTTCCGTGACCACACTCGAAGAGATATTTCTC
AAAGTCGCCGAGGGCAGTAGCAGTGCT