Transcript Name :
Phyra_72561
Orientation:
(+)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
BRCT domain8.972PS50172
HmmSmart predictionP-Valprediction_id
BRCT domain6.5SM00292
BRCT domain12SM00292
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BRCT domainIPR001357
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2781 bases(100 bases per row)
ATGCGAGCGCAGTGGGAAGGAGACCTCCGGGTGTTCTTGGAGGAAGACAGTGAGTATGTGCACTTCCTCGAGATTTTTGAGCAGGACCTGGTTCGGAAGC
TGCGGTTCAAGCGTCGGGCGCGAGACGGACCTCTCGTGGACAGCGTCGCCTTTGACCGGTTTGTGGAAACTGCCGCGCAGCTCCGATACTTCCACGTGCT
TTTCCAGTCCAAGTTGAAGGTGGTTTTGAAGCCCCAAGGATCAATCGAGGGAAAGTGCAGTCGTTTCGTGGAGATTCTGGCGGATATGCTCAGCGCCCTG
CGCGCTCTGTACGGACAGCTTTCCTACAGAAGCGAAGTCACCCAGGCAGCGCTGTCAAGCGCGTTGGAGAAGGCTGATACAGAATGGGACGGAACGCTGC
TGGACAAGTATCTCGATGAGCAGAAACTAACTCCAGAGAAGCTTGTTGCTCGCCCGTCAAAACGGTTTGGCGAGTTGGTGGAATTCGTCGAAGCACTGAG
TAAGACTCTTTCGGAAGATGACGGAGAGGAAACAATGAACAATAACAGCGACACAGGAAGTGGAGAGAAGCTGAATTATGCTCCTCAACTTATCCATATT
GTCCAGGAAAACAAGAACTATATTCACGTCGCCAAGACTGACGCACGCGAGGAGGAAGAATTAATTGCATTGCAGACGTGCTTTCGTGGCGATGGAGCAG
ACATTTTCAGTGATCTGTCCAACAACAAGCTGTTGTTGGACGGAGAAGTGTTTCTGTCGCTCTTGGGTGCTCAAAATGGTTCCAGTGGTGAGAGTGCTAC
TGCTACGGATCAGGTCAGGCACCATGAAAAGGTTCACGTGCATTGCTTAGAGGACGGAACGCTAGTTTGCAGCAAGCGGCAAGACACAGACTCCGGGACT
ATATTCTCAATCCAACACTGCTTTCGGCTGAAGCAGGAAACTACGTTCCTGGAATCTGTTCCAGCCAGTGTGCCTGTACTGGATCCCTTAGGCGAAACGC
GTGCATTGGCGCTGATCATGCGGGACTCGACGTTTGTATTTGCGTGGGAAGACCCGACCGAGAGTCAGCGATGGGCGGATACAATTGGAGGATTTTTGGA
AATGAATGGGTCACGGAGTAATGCACTTCATCAAGGACGAACGATTCGCGATCTTCCTGTTCCAGAGGAGATCATTACTCAAATTAAAGATAAGGACGTG
GCCCCGACAGATTTTGCATCCTTTTACGATGACCACCTTCCAGGCGTTTTCTGGATGCCGCCTGATATAGGCTCGGATCCAAACAAGGGGAAATGGGAAC
TGGTTGAAATTGTCTTTTTCGCTAGATGGCTGTTGGTTTTCAAGCTCCACGGATGGAAGGGGCACTCATTTTTGTGTCAATTCGATTCGTCCGCGCCGGA
GATGGAGATTGGCGAGCAGCCGCGAGGAAAGAAAGAGTGGAGCTTGGTCATTTCGAATGGAACTGCAGACCACCTCACGCTTATATCAAAGAAGCGAACA
AGAATTGACTTTTGGTTTGATCAAGTATGGAAGGCAGTTGAAAGTGCTCAGCTTGTGGCGAGGCGGGTGGAGAGAGAGAATACAGAGCGGCAAGAGATGG
AGGAAGAAGAGGTTCAGACACGTAGCCAGGGAAGCAAGCGGGGCGAACAAGCTGGTAAGAAACGCAAGGTCAGCATGGTAGCCTCCGCCGAGCAAGGCTC
AACGGAGGATGTGGATGAAGAGAAGAAGCGGAAAACCACATCCAATGCAAGCCCAACAGGTTCCATTGGCTCTAAGCCAGATGACAAAACGGATGAGGAA
TGTGGTGAACTTGATAAAAATTCTATGAGAATCTGCGTTGAGGAAGAGCGAGCTACCGCGCCACCGGCAACAAAGAAACCCAGGCGTTCAACAGCCAAAT
CGAAGCAAAGTACTCGAACGGACGCGGATGAAGAGGGCAGCGCATTTGCTGTCACTGCATCACCTGCTTTAAAAACGCCAAAGCGAAGGTGGCTGAAGAG
GAAATCGGAAGACCCCTACGATACCGAGTTGGTGCCGACTCAGCTTAGCCCGGCTGGCCCGACCGATGAGTCTGCTAGCGAGATTGACGCTACGCAAACG
CCCGCTAATAACGAGGTTCATGCTGAAGGCGAGTTGAAGGAGGTGCGGATTATTCTCACGGGCGTGGAACCCACTGCTTCGATTCGGAAGAAGATTGACT
CGATTGTTGGCGCAGTCTACGAAGAAGACGTCGAGAGGGCAACACACATCCTTGCCCCCAAGAATCAACTGAAGCGTACTGTGAAGCTACTGTGCGCCAT
CTCGTGTTGCTCTCACGTCTTGGACGTGCGATGGTTAGATGAGTCGGCTCGCGTGGGGGCTCCCACCTATGAGCGAGCGCACTGTCTTAAGGACTCCAAG
GCTGAAGCGAAGTGGCATTTTGACCTGGTGAAGACAATGTACGACTTCACCTCGGAGCAGCGACGACAGCTCTTCGCCGGCCACCAGGTGTTCATCACTA
ACCATAAGTCGGTGCTGCCGCCGGTGAAGGATCTGGTGAAGATCGTGGAGTGCGCCGGTGGAACAGCCGTGATCAAGGGCAGCGCAGGCCCGAACGACGT
GGTGATCACAAGCGAGGCAGCGCTGGCCACTGCCTCGGTGCGAAAGGCGCTGACGCAGGCGAGCCCGCAGCGGATCTACTCCGCCGAGCTCATTCTGATC
AGCATCCTGCAGCAGCACATCGACTTCGACCAGAACCATCTTGAGCAGACGGGTGATGGCGGAAGTCGCCGGCGCAGGTAG