Transcript Name :
Phyra_72563
Orientation:
(-)
Number of Exons:
2
Description :
Cytoskeletal protein Sojo, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
BRCT domain10.085PS50172
BRCT domain8.916PS50172
HmmSmart predictionP-Valprediction_id
BRCT domain0.15SM00292
BRCT domain1.6SM00292
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BRCT domainIPR001357
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.8485.2610.011
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1962 bases(100 bases per row)
ATGGCTGGCGAAATGGCGTGCATGTTTGACGGGGATTCATCCGGGCAGGAGACCCCCGTGGGGTTTCGAGACACACCAGGGCAATGGTACACGGCTAACC
ACCGCAAGCGCGCCGCGCTGCCGCAGCTGGAGGGGGAACCGACGCAACGAGATAGCCAGGCCACGCAGGTAGCGACGGAAGGGACGGCGCCGCCAGGGGA
ACGTCGCGCGCCAGTGTTCGTAGCTGCTACACCCTCGCAAGAGGAAAATGATGGGCCCCACCAGAGTCAGCACGGTGAAGACGAGTTGGACGAGGAGGAG
ACGCAGATCCGGATGACAAATTCCGAGGAGCAGGACGGTACGCAAAGTACCTTTTGAGAAGGATTTTAAGCGATGGAAGGTGGCTTAGTGAGTTCTGGAT
GCTTCGTAGGCCCCAAACCGATTCAAAGGATATTTGAGGAAGCCGTGCCGTTGCCGATAGCAGGTGGAGCCGTCGGAAACGGTGGCAACGCTTCAATGGG
GAACAGTGACGACGATGCAGACTCGGACATGTCGGATGACATGCTGGAACAGGACGGTTCTGTTGCTGGGTTATCCTCCATCGCTGCTTCTTTCCAGCAG
AGAGATCAAATTGAAGAGGTCGTGAAGAAGAAACTGTACAAACCTCGTGCCCCCTTTCGAGCATCCCTAGTTTTTTCGACTCGTGGCGACTCGGAAAGTA
GCGGTGGGGAGACTGAGATCGAAGGTGAACCGAATGAAGTAGTCTGTGATAAAGGGGACGCGATGCCCGAAGACCGAATGCCGCTGCGTCTTACTAAAAG
CGCAAGCTACTCGACGGCGGGTGCAAAAGAGGAAGCACTTCCATCTAAAGTGACGACTATGCACCGATCGCTATCGACTCCAGAAACGACACTCAAAACA
AGGTTGCCGCTCCGCAACTCAAAGCGAGACCCCAGTGGACCCCCTGGTGGTGGCCCTGCGAAGTCAAAACGATCTCGCCATAGCGAGGCTGGAGTGTCTT
CTCACAATTTGGACCAGGAGGATTTGGTGGAGAAGAAAAAAATGCCGAAGCAGGGCGATAAAGGCCTTCAGCAACAAGCTTCAACGAAACCGCGCAGCGG
GTCTGATAAAATTGCTGGAGCAGCAGAAAGCCTTAGTGATGATAACGGCCAGCCTTCCGTTGAAGTTGCTGAGCTGGGCGAGGCCTCTGCGTTGCGATCG
ACACCGCGTTCCACGCGCAAGACGTCTGCATCAAGCCACAGTCGGAAGCGGACGACTAGCAATCGATCGGTCACGGACAGCGAGTCCGCAGGTTCACAAG
CGGAAGCCAGGTCTATTCGCATCGTCTTGACAGGGCTGGAGCCCACTGCTGCAATCCGCAAGAAGATCAAGGAGATCCCGGGCGCGGTCTACGAGAGCAG
CATTGAGAAGGCCACGCATGTGATTGCTCCTCAGAACCAGTTGAAGCGCACAGTGAAGCTGCTGTGTGGTATCTCGTGCTGCACACATATTCTGGGGGAA
CGCTGGCTGGACGAGTCGGCGCGGGTCGGCGCGGCGGTTGATGAGCAAGCGAACTGCCTCCGCGACGTGGAGGCGGAAGGCAAGTGGCAGTTTGATCTGA
GGAGCACCATGTACGGCGTCCCCGTGGAGCAGCGCCAGCGTCTGTTTGCTGGCTTCAGTGTATTTATTACCAACCACAAGTCCGTGCTGCCGCCGGTGAA
GGACCTGGTAAAAATTGTGGAGTGCGCTGGCGGGAAAGCGACGACAAAAGGGAAGCCCGGCGTAAATGACCTGGTGATCACGAGCGAGGCGGCACTGGAC
GCAGCTACGGTGCGAAAGCAGCTTGTGAATGCGAATCTCAAGCGGATCTTCTCCCCGGAACTGATTTTAAGCAGTATCCTGCTGCAGCGAGTCGAGTTGG
ACAAGCACCGGCTGGAACAGCCAGCGATCGGCAAGGCATGGGCCACCAAACGCCGAAAATAA