Transcript Name :
Phyra_72584
Orientation:
(+)
Number of Exons:
1
Description :
DEAD/DEAH box RNA helicase, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RNA helicase, DEAD-box type, Q motif6.619PS51195
Helicase, superfamily 1/2, ATP-binding domain29.327PS51192
Helicase, C-terminal9.971PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain7.3SM00487
Helicase, C-terminal3.1SM00490
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RNA helicase, DEAD-box type, Q motifIPR014014
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.6452.1770.004
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
Cluster Id
2256
Sequence
        2061 bases(100 bases per row)
ATGGCGCAGCCCAAGGTGAGCGAGACGCTACTGGATGGACAGAAGGCCTTCGCCGAGTGCGAGTTCGGCCTAGACCGCCGCCTCACCAAGGCGGTGGCTA
AGATGCGCTTCGTGCACGCTACATTGGTGCAAGTGCACTGCATCCCTCTGGCGCTGCAGGGCAAAGACCTGCTGGTGCGTGCCCGCACGGGCTCAGGCAA
GACGGCGGCTTTCGCGCTGCCGCTGCTGCACAAGATCCTGCAGCACAAGCAGGACGCGCCCGCCAGCGACCCGGCCGTTCGCGCGCTGGTGCTTGTGCCC
ACCAAGGAGCTCGTGGAGCAAACGCGCCGCCACATGACTGAGCTCATGTACTACTGCCAGGACACGGTGAGTCTCCTGGCGCTGGGCGGGCAGAGCATGA
GCGCGCAGCAGGCACTGCTGCGTGACGCCCCCGATGTGCTGGTGGCCACGCCTGGCCGCCTTGTGGCGCACCTGGAGGCTGGCAACTTGACGCTCAAAGA
ATCGGTGCAGACCGTTGTCATCGACGAAGCGGACCTGGTGCTGTCGTTCGGGTACGGAGAGGACATCCGCACGATTTTCAACGCGCTACCTAAGGCCTGC
CAGACGTTCTGCATGTCGGCGACGCTCAGTCCCGAGCTGGAGAAGCTCAAGCGCTCGGTGCTGCACAACCCGGCGGTAGTGAAGCTCGAGGAGGGAGCCA
CGGACGGCAAACTGCAGCAGTTTTATCTGCCCGTGAAACCCGCTGACAAGGACCTGCTGCTGTACGCGCTACTGCGCCTGGGCGTCGTGAGCGGCAAGGT
GATTTTTTTCGTCAACTCGACGGAGGCGGCGTACAGGCTCAAGCTTTTCTTTGAGCAGTTCGTGATCAAGAGCGCAGTTCTGAACGCGAAGTTGCCGCAC
AACTCGCGTCAGCACATTATTGAGGAGTTTAACCGCGGTCTCTTTGACTACCTTATTGCCACGGACGACAGCGTGGATCGCGACGTTGGTGAAGAGGACG
AAGAGGACGAAGAGGACGAAGAGGAGGAGGAAGAAGACGAGGACGCTGATGAGAAGGAGGACGACGAAGAGAAGTCTGACACTGAATCGGACGCTGTGGA
GGAGGACGAAAAGAAGGGTGATGATAGTGATAGTGACAAGGAAGAGGATGACGATAGTGAGAAGGAGGACGATGAAGCCATGGACAGTGACGATGACGAG
GCAGATGATGCTGATGAACAGAAGCAGGAGAAGAAGTCGGTGGGCTCCAAGCGTGGGCGTGCTGACGATGAAAGCTACGGTGTGTCACGTGGTGTTGACT
TCCGCGGTGTTCAGTTTGTTATTAACGTGGACTTCCCGAAAAGCGTGCGCGCCTACACTCACCGCATCGGACGTACCGCGCGTGGTGGTGCCTCTGGTAC
GGCGCTGTCTCTCGTGTCCAAGGATTCCCCCAAGGAGGAACGCGCTCTGAAGCGTGTGCAGGCGAAGCAGCAGGCCGTCCGCTCCGAGGCAAACGATGTT
CTCGCACAGCCTGCGGAGCTAGCTTTCGACCTGAAGGAGATTGACTGCTTCCGCTACCGTGTGGAGGACGTCCGTCGTGCTGTCACGCGCGTGGCCGTGC
GCGAGGCGCAACTGGCTGACGTGAAGAAGGAGATGCTGAACTCCGAACGCCTGGCAGCACACTTCGAGGCTAACCCGCGTGATCTGAACATGCTTGAGCA
CGACAAGGTGGTGGGCTCTGCGCCAGTGCAGCTCCATCTGGCGACGATCCCGGACTACCTTGTGCCTATCGAGCTGCAGCCACCGGCACCAGCACGCACC
AAGAAGAAACACAACAAGCGGCAACGCATTGCCGACGGCAAGCGCCGTACGGACAACGACCCGTTGCACACGTTCGTGGCCCCTGACGCTGATAATGACA
AGAAGCAGACTGTGGAGGATCGTATCAGCTATGGTAACAGCGGCGTGGGTAAGAGTACTGCCGGTCGTCAGCAGTGGAAGAAGCAGCACCGCAAGGGCCA
CTTCAACCCGAAAACGATTGCCAAGAAGAAATTCAAGATGAGCAAGGGCGCTACTCATTAA