Transcript Name :
Phyra_72592
Orientation:
(-)
Number of Exons:
1
Description :
PREDICTED: coiled-coil domain-containing protein 12-like
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.8284.8150.01
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        432 bases(100 bases per row)
ATGGCGGGACCCGATGCGGACGATGCGATGCCTCGCGCCAAGCGGCTGAAGCTGTTGCGCGAGGCCAAGATCCGCAAGGAGCGTGGCGAGAGCAGCAGTG
GCGAAGCTGGCGCACTGGTGGTTGCAGGGGTGAAGCCCGTTGAGGACGAACCAACGCAGCCGAAGGACCAGGAGGACACCGATATGCCCGACGCGGACCA
AGCTCCTGACAAGACAGAGGACCTCGTGGAGAAAGTGGCTCTGGCGCAGGAGGAGGACGCCAAGACAGAAGACGAGAGTGAGGACGAGCTGCTGAATTTG
GCGCCCAAGCGCGCCAACTGGGACATGGAGCGCGACATCGCACCCATGCTGCGCAAGCTCGAGAAGCGCACGCAGCACGCAATCGTCGAGATCTTGCGTA
CGTTTGGAGCTCAGCTTGGCACGTTGTTTTGA