Transcript Name :
Phyra_93231
Orientation:
(+)
Number of Exons:
18
Description :
calmodulin-binding transcription activator, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
CG-1 DNA-binding domain13.577PS51437
Ankyrin repeat-containing domain25.461PS50297
Ankyrin repeat9.271PS50088
Ankyrin repeat14.853PS50088
IQ motif, EF-hand binding site7.895PS50096
IQ motif, EF-hand binding site7.913PS50096
HmmSmart predictionP-Valprediction_id
CG-1 DNA-binding domain2.4SM01076
Ankyrin repeat98SM00248
Ankyrin repeat6.3SM00248
IQ motif, EF-hand binding site0.78SM00015
IQ motif, EF-hand binding site0.0069SM00015
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
DNA bindingGO:0003677IEA
nucleusGO:0005634IEA
*** None ***
Cluster Id
1904
Sequence
        5874 bases(100 bases per row)
ATGGGGGAGACTGTGGTTGGCACTCGCCTGCACTGGCATAGCCACTCGCAGCGCGAACGCATCGACGTGGGGAAGGTGCTGGGTCAAGTGCGTGCGTTTT
GTGCTCGCGCAGCTACCTACTCTGATGGAGGAATCCTAATTGCGGTGGGGCTGCCTGCAGCGCTCGCTGGATCCATTGCAGCCCCTCCCTCATCAGCGAG
CGAAGATTCATCCTCATCCTCGACCTTCATCGACTCTGTACGCGACCTCATGACTCAATTGCAGAGCGAAGTGGCCACAGGGACTCTTGCCGGCAAAGTG
GAGATTATCCCGATGCTGCACTGGGGGAAGTTCGTCCCAGCATTGAACGCGTTGGTTGGTGCGGCGGCAGATCACTTCCCCAAGGCTGACACACTGCTGC
TGCAGTCTCTGGAGGTCGCGGTGGACGCAGCCAGCATGGAGGCCCTACGCTCGCACTTTGACATCAAGCGCGATCTTGTGGTGGGCGCAGCGCTGCCTGG
CCACGAGTTTCAACCGAATCCGGCGACCCAACCGGTCGAGCTAAGCGGCTTGACATCTCCGTGGAACACGCTCGCGCTCTGGAATCTGGAGCAGCTGACG
AAGGTCGGCTTCGCTCTGATGGGCGATGCATTGCGTCTCGAGGTCGATGGAATCGGCTCTGCTGCGGGCATTGAAGAGGTCGCCACCATCGCCATGTACC
AGCAGCTCTACGCGAACAGCACGTCGCCCACAACAGCGAAGTTGGTGCGTGTGCCCAGCATCGCGTGGCAAGTGGACGGACTGGAGGACCCTAAACGGCT
CGAGTGGCATCAGAAGAAGATGGCGAGCAAACTGCAACGCGCAGCAGCTCAAATCGCTCACTTTGGCGTAGCACCTGGACGTGTGCATCACCTGGAGGCG
TGAAGCTGAAAGTTGGGTCTACCCATTTAGCTTTTCAACCACCATCCGTGAAATACAATACAAGCAGGACCTCGATGTCCGTTTCTGAATCTGATACCGC
GCGATGTGACGCATTTCCATGACACTCGCCAAGCAGCACTCGACACTGCAACAGCATGACGGGCACGACGGTGGTGGGCACGCGGCTCCACTGGCAAAGT
CACACCCAGTACGAGCGGGTAGACGTTGACAAGTTGTTGCGTCAACTGCGCGAGTTCTGCGCCCGTGCAGCGACGTACGCGGATGGCGGCATCCTCATCG
CTGTGGGGCAGCCAGCTGCGACTGCCACAACGATCACCGGAGCACCTGCCTCGGGCGCTGCCGACTCGATCTCGCCAACATCCTCCCAAATCACAAGCGC
CTTTGTTGATTCAGTGCGCGAGTTCATGACGGAGCTACAGAACGAAGTGGCGACGGGCTTGCTCGCCGGCAAGGTGGAGATTGTTCCAATGCTCTACTGG
GGCAAGTTTGTGCCGGCACTGAATGCTCTGGTGGGCACAGCGGCTGACCACTTCCCCGACGCTGACACGCTGCTACTGCAGTCTCTGGAAATCGAGGTCG
ATGCTGCTGGAGTGGCGTTGCTACGCTCAAACTTCGATCCTGAACATGATCTCGTCGTGGGCACGGCACTGCCCGGGCACGCCTTCCAACCCGACCCTGC
AGTACAACCACTGGAGCTGAGCGGCTTGACGTCGCCGTGGAACACTCTGGCGCTGTGGAACTTGCAACAACTGACCAAGATCGGGTTTGCGCTCATGGGC
GACGCGCTGCGACTGGAAGTGGAGGGCATTGGGCCCGCCGGAGGTGACGAAGAAGTCTCGACCATTTCAATGTACCAACAGCTCTTCGCTAACACGCCAG
CCCCCACGAGGGCGAAGCTCATCCGAGTCCCGGGCGTGGTCTGGCAGGTGGCCGACTTCAAGGACCCAGAGCGCGTGGCTTGGCACACGATGAAAATGCG
CAGCAAGAAGCAGCGCACTGCCGCGCAAATGGCGCATTTTGGCGGCGTGGCTCCAGGCCGCGTACACCACATAGAGACTACCCTTGGAAACGGAGCAAAG
TACATGTAAGCTAGAGCCTAAACAGCCAGGAGCAAACTGCAGCCGACCTCGATGACTTGCTCCTGTTTTGCGACACTGCGACGGACATAATCATGAAACT
CACGGTACTCGTCGTCTCTTGAAGCCAAGGCGCCAGACGACGTTACGGCGGCGAATGAATTTGGGCGATGGCATCCAGGCGCGCGCGGCCTCTCTGCGCG
AGGAAGCGACGCGGCGCTGGCTCGTGAAGGACGAGTTAGTGTTCTTGTTGCTGCACTGCAAGCTGGTGGGCGTGCCGGTGCTCCACTCGCTGCAGCTGCG
GCCGCCAAGTAGGTCTCCCGTCGCGTTGGTCGCGCTACTTAATTGTGCAGGCCTAACGCCATGTTGCGATGATGCGCTCGTCTTCACTGTTGAATGTTTG
CTTGGTAGGCGGCTCGCTGCTGTTCTACAACACGTTGGAGGTCTCGGACTACAAGAAGGATGGCTGGCACTGGCAGAAGCGCAAGGACAAGAGCGGACGC
GTGAGGAGACGACGCAGCGTAGGACTGAGTCGAGGCGAAATGGCGTTCTCACTGGTGTTATTGTGTGTTGCAGGTTCGTGAGGACCGAGCGAAGCTGGTG
ATCAACCGAGAAGTGATCATTCTAGGGACGTATGTGCACTCTGCTGAGACTTCGGTGAGGAGATCTGCTTGGCAGGATGGAGACAATGGAATACATTGTT
AATGGATCGTGTTGTGTGATTTTTGATTGAAGACGTTCCATCGGAGGATTTATTCTGTGCGCGATTCCAAGGAGAACATTGTCCTCGTTCATTACTTTGA
CGAGATTAACAAGGAAGCTGCGGCACGCCAACCATCCTCTCAGGAAACCAAGAGCACTCACAGCAAAAACAAGGGGGTGAAGCGGTCGTTGACTTCTTCT
AAGACGAGTACTACCCCAGCAGGCCTCTTATCATCATACCGGCAGGCGAGTCCGCTCAAGCCTTTATCATCTGAAGAAACGGTGGAATCCATCATGAAAA
GTATGCGTGCGGTATTAGCGTATTAACTCAAACGATAGCTGTCTGACACGTTCTTATGCGTTTCCGCGCGTAGACTGTTTCGAGATGGACTTTGAACCAC
TGGCGATTTCGGCTCAAAACTCTTCGACCAACGTCTCCGACCTGGACCTACTGCTTAGGGACAATTCGATGGACGGAATTACGACTGGTTTTGGTGACGA
GGAGGTATTTAATGACCTCGCTTCTGCAGTATCTCCCGAAAAGAGCGCCAGTGGCCTAGGTGGTCAACAGACATTTGAACTGGCTGAAATATCGGATTTC
TCGCCGGATTGGGACTTTGGTGACGGTGGAGCTAAGATTCTAATCTGTCTAGCAGCAAAGCTACCAGAGAGAATGGCACAAGATCCGATGAAGTTGTTTG
TACAGTTTGGGGGAAAGCAAGTGCGCGCAGAAAAAGTGTCGGATACTGTGCTTCGGTGCACTGGTGAGTACATCAGACAGCAAATTATGATACGAGTTTG
GGTCGGAGGGCAAAACTAACCACTTGTTAACCGTTCTTATGCAGCTCCTAGTTCACGCGAACTTGGCAGCGTTGACATTTATGTTTGCCATTGGAGTGAG
TCCCAATACCAGGGAAATATTCAGTTGTCCCACAAGAAGCAGTTCACATACCGGAGTCATTATCAGGTGTCTCCTTCACTGGTGGGTGAAATTGTGAAGG
AAAATCTTGTTTCTGCGGAAGAAAACATCGATCCCTTGGAGCTTGCTCCTGCGCACGGGATGCTTGGCACTGGCAAGCGAGGTCGGTCGCCAACTGTTCA
TTCCCGAGTTGTCGTGGACTACAAGCGAGCAAATGACAGGCAGACTGGATCGAACAGGAATCTATCATCATACGTGGAATCCGATTGTAAGTCGTTCATT
TGTTCTGTACGAGACTTTGTTTGCTCACATGTCCACCCTTTTGAATAATGCGTTGTATAGTGGACGAGCGGCAGTGCAAGATTCGAGTCGTGGAGCGGTT
GTCAGAGTTCCACCAGGCAATACGGACGAGAGCAGCAGAACCGACTACCAACAATGCGTTTTTGTTTGATCCGCACAGTATTAGTGGCGAAAAAGGAGTG
CTCTCAGAATCTGACCATGGACCATCTTCTCCAACTAGGTCACCATCCACAGATGCGTCGGCTAGACAAGAACATCAATCAAGCCAGCCGTTGTCTCAAT
CAAGTGGTTCTAATGACCCACCCAGCACATTGATATCCTCTAGTGGGAGACCGATTGCGTTGGACGACTGTACGATCGAGGCACTGAGCGACAACGATCT
GGAGCAATTGTCTGAGAAACTGCTGGAGCGTGTTGTGCATCAGCTTGTGACAGTGGCGCACACGAGTGAAGAGCTGCTGGAGGAACTCAATTCTCTCGAT
GAAACTGGTCTGAGTCTGCTGCACTACGTGAGCTTCTACAATTATTCACAACTCGTGCCAGTGCTTGTCGCTCATGGTGCACATATTAACCAGCAGAGTA
CTCAAGGCCAGACAGCACTCCATTTAGCCGCAGGGTGCGGTCATAACGAAGTGGTAGATGTACTGTTACAATCTGGGGCAGATTTACAAGTGCGTGACTT
TGACAAGCTAACTCCTGCCGATCGTGCTGAGAAGTCGGGTCATACAGACGTAGCATCGAAGCTGCGTCATCACATGGGAGGTGACGGAGCAGAAGACTTA
GAAGTTGTCGATGAAATTTATGGGTTTGGTGGATCGCCGATGGAGATTGACGATGCCCCCACACCTTATATGGATGCTGGAGACATGGGTCTTCTGGAGA
GCTATGGTCACATGGGGCCTACCGGTAGTTCCTACCCCGCTCGTTCTCACTCTAACAGTTGCGAGAGCCCCTGCGAAGCAAGTTTATCAGCGAAGTCTAC
TTCATACGTACGTTATCAATACTCCGTGTGTTGTTGCAAGGCACTGATGATATGATCACTACGTCGACTTGCGTTTGTTGATTTTGCAGGTAGGAGAAAA
TCAAGAGCACAATCGGAAGCTCCTACTTGGAGCCTTTTCTACCATGAGTTTGCACGACAAATGTGCTCTCTCGTTGAGTATCTCTAGAGACTCAGTTGGC
CACCCTGTCCGGCGTCGTGATAGCAGCGTTGGTGAAGAAATTTTAAACTCTCCTAGTTGCAGTAGCACGGGGACATCGGCGGGCTTTGGCTCATCTCCGG
CCAGCATGGTTGGCATGGACTCAAATCTTGTCGGTAGTCGATTACTGCTATCTGGAGGGGAGAACGACTCGGATGTTCAGAGTGTAATTGCCGAAGATGA
GGAGAGCCTAACAAAGCTTCAAGCGGCCATGGAGCTAATGGGTCCGGAGGAGAAGCAGTCCTTAGAAGACGAGGTGAAGGTTTTGCAACACGGTATCCGC
GCATGGCTGCTGAAGCGGAATTGTAAGAACATGCGTGAGACGACCAAACAGTTATGTGAAGCCACGCAGAGTATTCAGGACCAGCAAAAGCAGCATGAAG
CTGCAGAGCCAAGCGAGCTGTCAGAGCGCGAGCGTGCCGCTGTTACCGTCCAGGCAGCAACACGCAGCATGCTGGCACGCCGCAGTTTTCTGCAGACCAA
GCACGTCGCTATCAAATTTCAAGCTGCCACTCGCGGTGTTCTCTGTCGGAAAAACTTCGCGCGCATGAAGGCGCACGCACTCGCATCTCTGGTCATCCAA
CGCAATGTCCGCGAGTGGTGGAACAAGCAGCCAGCAGCCTCACGACCAGGAAGTCTCGATAAAGACGCCGACGACGAAGAAGAAGACACAGACAGAAAAA
TCGCTCCAATATCTTTAGGAGCATTTGATCACACAATGCGTGACGAAGAGCAGCGCGATTCACTTAGCACGTAG