Transcript Name :
Phyra_72570
Orientation:
(-)
Number of Exons:
5
Description :
Major Facilitator Superfamily (MFS)
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain9.166PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
Y-scoreD-scoreY-pos
0.6970.78227
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1940 bases(100 bases per row)
ATGGAGAAGAGCGAGCTGCGCGTGCGCTGGCTGGTGCTGTTCCTGTCGTGCCTGTTGATGATCGGCAACTACTATTGTTTCGACAACCCTGCGGCGCTCA
AGAGCCAGCTGCAGCAGCACTTCAGCAACATCCCCAAGAGCCGCTACGAGTTCCTCTTCGTACGTTAGGCCCCCGATCTTATTTGTGACGGCGCGAATTG
CAATGGTTATCAAGGCAAATACGATGCTGCAAATAATTAAAACTAAATATTGCGATTGTGGCTGCAGAATTTGCTGTACACATTGTACTCGATCCCCAAC
ATCTTGCTGCCGTTCTTCGGCGGCGTTTTGGTTGATCGCTTTGGGGCGCGCGTGATGCTCTTCGCCTTCTCGACAGCAATCCTCACGGGCCAAATAATCT
TTGCAACTGGGTGCTCGCTCTCCAGCTTCAATATGATGCTGGTAAGAGCCTGCACAAGCTGACGACATTGAACGCTGCTGACTTTTGTTGTTGTTGTTGT
TGGTACAACTTTGCAGTTTGGTCGAGTGGTGTTTGGATTCGGTGGAGAGAGTTTAGGTGTGGCACAGGGAACACTCGTCGCCTCGTGGTTTAAAAACAGT
GAGCTTGCTCTTGCGTTGGGGATCAACCTCAGTGTTGCTCGACTTGGAAGCGTCATCAACAACGAACTGAGTCCAGTTGTCGCTCAGGATTCGAGTGTTT
CGACGGCCCTGTGGGTGGGTGTTATCATGTGTATAGCCTCTACTTTCATGGTGTTGCTTGTGATCCCGATCGACAAGCGAGCTGAGAAGTTAACACAGGA
AAACCAGAAAGAAGGAGGTGCGGCTGCTGAAAGCATTCACTTTAGCGATATCAAACACTTCCGCCCAGCGTTTTGGCTACTGGCGCTGAGCTGTTTGGTG
GTCTACGGCTGCGTTATTCCCTTCAATAACGTGGCCAGCAGTCTTTTAATGGAGCGCGACTTTTTCAAAGAGCCTCCCGAGATGTGCCGACGATGTGGTG
AAGGGCTCTACGATACTGAAGTTGATTGCCCAGCAATCGTTCCAGGATGCCCCAGCGTTCCTCCATATGGATGGCCACTCCCGTTGCTTTCTGCGAATTG
CACGATCAAGGAACCGGAGGACCAGTGGAACTGCTCGACTTCACCTCCACTGATCAACGGTGACAATATCAATTGTGATGACGCGGCATGGAAACTCGGG
CCGTTGACGAAGACATACTGCGCCACGAAAACGGATGCAGCGCAGAAAGCAGCTACGCCAATGTCCATCCCGTACATTATCAGCGCCGTCATATCTCCGT
TTCTCGGATTTGTAGTCGACCGAGTCGGCCTCCGCGCCTTTTTGGCACTGGTGGCGCCGCTTGCCCTGACGGCAGTCCACGTCATGCTCGGGCTGACCCA
TGTAACTCTGTACGTGCCGCTGGTGCTCCAAGGCGTCGCCTACAGCGTGTTCGCAGCGGCGCTGTGGCCCTCTGTTCCGTGTAAGAGCTTTGAAAGTGAT
CTTTCATTAGGCGTTGAATCTGATCGTTCTTCTTTGTGTTATGCAGATGTGGTCCAGGCAAAGCACGTTGGAACTGCGTACGGAGCCATCACCGCCATCC
AGGTGCGGACCCCGCCCCCTGTTTCTTGCGCTGTGTGGCGTTGCTTGATTCTAAGCATTTGTATATTTGTGTGTGCGTATCTTCCCAGAACATTGGACTC
GCACTATTTCCGCTGGCTGTGGCGGCGGAATTCAACCACGACGATCGGTACATCCCCGGCGTGGAGCTTCTCTTCGTGTCGTTCGGCGTGCTGGGCAGTC
TAGTGGGCATCGCCCTCAATGTGGTGGACTACCAGAACGGATCCATCCTAAATCACACGAACGCCAAGAAGAGGAGGATCTCGCTCATGCTGGACGAGGA
TGCACTCGACACGGAGGCGTTGCTGGCCGCCGAACACTAG