Transcript Name :
Phyra_72569
Orientation:
(-)
Number of Exons:
7
Description :
NIMA never in mitosis protein a-related kinase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain47.976PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.9SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.7433.7950.008
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
Cluster Id
1944
Sequence
        1475 bases(100 bases per row)
ATGGACGCGTACGAGCAGGTCCGCATCATCGGCAAAGGCTCGTTCGGCGTCGTCACGCAGATTGTGCGCAAGGCCGACCGCAAGGTGAGCAGCTATGGAC
TCGCAGAACGGACGCAATGTGTTCAGCATTCAGAGACTAACTCGTTAATGGCTGCAGACGCTCGTGTGGAAGGAGGTCAACTATGGCGCCATGAGCGAGA
AGGAGAAGCAGCTCATCGTCAGCGAGGTGCGTTCGACTTTTCCTCGAGAGGGGTTGAATATGCTGATTTTGTATGGGCGTCTTCTCTACACAGGTGAACA
TTCTGAGGGAGCTGCGCCACCCGCACATTGTGCGCTACCTGGACCGAGTGATCGACAAGCAGGCCACCAAGATTTACATCGTCATGGAGTACTGCGAAGG
TGGAGACCTCGGCCAGTTCATCAAGAGGAAGAAACGGGAAGGGTACGCACTTTCACCGCCTGTCCGAGGAAATCATATCATACACTGGGTGTTAACCTAT
GCCTTTGTCGTTGATGGCAGGTCCTACATCGAAGAGGGCTTCATCTGGCACATTTTCACTCACATCTTTCTGGCACTCAAGGAATGTCACCGCCACCGTG
AAGGCAACGCCATCCGCCCCATTCTGCACCGTGACATCAAGCCTGGCAACATTTTCCTAGACTCCAACGTACGCCTCTGATTTTGATTTCTTTTCTTGTG
AGGGTTCTAATATTCCATTTGTTTTTTCAGAACAACGCCAAGCTCGGCGACTTCGGGCTTGCCAAAGAGCTGAGCAGTGAGTCCCGCTTTGCCCAAACGA
ACGTAGGCACCCCATACTACATGAGCCCGGAGATGGTGAATGAAATGACCTACGACGACCGTTCCGACATTTGGGCACTAGGCTGTTTGCTTTACGAGAT
GGCCACGCTGGGCCCCCCTTTCGACGCTACAAACCAACTGGCACTGGCGAAGAAGATTAACGCCGGCAAGTTCACACGGATCCCGTCGCAGTACTCAGAG
GGTCTCTTTCAGGTCATTCGCTGGATGCTGCACAGACAACGTTCCCGACGACCGAGAATCGAGGATTTGGAGCGTGTTCCGCAGCTGCAGCAGAGATTAC
GTGCGTACGCTGCTGCTAACACTCCGCAGCCAGCTGCCGACCAGAACCTGCAGACGTCTTACAACCAGAAGATGAAGGAACTGCTTGGCATTGAGGAGGA
TCTGCGCCGTCAGGAAGCCGCTCTCATGGCTCGTGAAAAGAAGCTGAAAGGTAAGAAGTCAGTATCGCTATGTTGCATTCAGATCAGTTAGCTTACGCTG
CGCTGTGTTGTTTGTCCTGCAGAGTTGGAGGTGGACTACATGCGTCGCGAAAGTGAGTTGAAGAAGCGGGAGCAGATGGTAGAAGTGATGACACGCAAAT
TGTCGTACAACGCTGCCAAAGTGGGATCCCCAACAACTTCTGATGACTCAAACTCCAGTGCAGACAACAACTTAA