Transcript Name :
Phyra_72566
Orientation:
(+)
Number of Exons:
1
Description :
kinesin heavy chain, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, ZZ-type12.961PS50135
HmmSmart predictionP-Valprediction_id
Zinc finger, ZZ-type1.7SM00291
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        876 bases(100 bases per row)
ATGGGTGCCGTGCTAGGTGATGTGAAGACGCGCTTAAATGCCCGCTACCACAAGAATCACGTCCACGAAAATGCTCTATGCGATGGCTGTGGTATGAGCC
CCATCGTCGGTGGGAAATGGAAATGCAACACCTGCGAGAACTATGAGCTCTGCGACGGTTGTTACGCGGCAGGGATACATGGCTACGAGGTGAGCAACGA
GTTGTGTCGCTGCATAGAGCAACTCGCGGTGCAGAAGCACCGCCTTCTTGGCGAGTACCCAGAGCTCTTCGAACTATTCCGTCGCCACATTTGCCACGAC
AATGTCATTCAGTTCCGGCGCATTGTAGAATGGCTTTGCGCGATTGTATCCGGGGCGCGCTCGGCTGCGATCTACCACAAGATGATCGTAAAACGTGGTC
TACACCCGGAAATTCGAGCTCGACTGGTGGCACAGCTCGGTGCGTTGGCAAGCGAACGCACCGACATCTCGTTGAAGACGGAGTGGTTGGCTGAGAAAAC
GCCCGAGGAAGGAGACGATAGCCAAGGTTCGGACTCAATGGAGCCCGCACCGGTCGAGCTGGATGGGGACAAACTGTCGCCTACGAAGATTGTCGCGTCA
CCTGATGTCAGACTGGAAACGCTGCGGATGTATCTGATGACCGCGTCTTCGTTGACGATGGCCAGTGATCCCGCAGCATCCACAGCGCTATCGGATTTGC
TGGAGCCGGCAGCAGCGCAAGCCCCAGCACTCCGACGAACCGTGAGCGCCAAAGAAATGTCGACGGTCGACGACCAGGACGAGAACGAGCGTGTGGGTCG
GCTGCCAGGCATGCCCTTAGACCTTCCGTTGTACGGCCGCCAGCAAGTCAAGTCGATTACTCGAATGAATATGTGA