Transcript Name :
Phyra_72797
Orientation:
(-)
Number of Exons:
2
Description :
myb-like DNA-binding protein, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Myb domain12.992PS51294
HmmSmart predictionP-Valprediction_id
SANT/Myb domain1.9SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Myb domainIPR017930
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
*** None ***
*** None ***
Sequence
        897 bases(100 bases per row)
ATGATCATGATGCCCGCCAGCGTAGGCAACCTCGTCGTGGCGCCCGCGCCTTCGACGCCGATCACGCGCGGCCTCTGGTCCGAGCAGGAGCACGAACAGT
TCCTGCACGCCATGAAGATGTTCCCTACGGGTCCGTGGCGCTCCATCGCCGCCTTCATCGGCACGCGATCCATCAAGCAGGTGCAGACCCACGCGCAAAA
GTACCAGCAGAAGATCAACCGCCGGCGACGCGGCTTGCGCAAACAGAAGAAGAAGTTTGTGCGCCCCGAGCACCGCGTGGACGCTCACGCTACGGGCTGC
ATCCAGCGCGTCAAGAACTTCACCATGCAGGGCTCTCCGCGCTCGCCCTCGGCCTTTCCCATTGGCGCTATGTCTCCAATGAGCGGCGGTTTTGGCCAGC
TTCTTACGGGCGGTTGCAGCCCCGTGGCCAGCGACGCCGGCAGCAGCACCAGCAGCATTTCTAGTCTGGACCTGGACACCGACACGGACGCAGTGTTGCA
CAACCTGGAGCCGCTGCCGTTCACATCTGGAGTTTCCTACGACGAGCTCCTGGCTGACGATGCCTACCGGCAAGACGTGCAGGAATCCATTGACCTGCTT
CTCGCCTAATTTATTGCGCCAATGCGGCAATCCGTAACCCTTCAAGAGCACGGCAGTACCAGCCGATCGCAGAGAGATAATATCATTTATACACTCGTTA
TCCTTAACCTTGCTGTCTAATATGTTAGTCATGAACTACTCACACCAAAGCGCACGACGCTCGCGAGAAAGCAGAAGCAATGCGCCATTCAGGCTGCGTC
CACGGTGCGAGCGAGCTCGTGCCGACAGATCGAGACGCTCTCAGCGTGGAAGAGGATGCAGCACAAGCTGAACGAGATTGAGAAGAGCAAGATCTAA