Transcript Name :
Phyra_72591
Orientation:
(+)
Number of Exons:
1
Description :
cyclinH putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Cyclin-like1.9SM00385
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclin-likeIPR013763
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K06634
K06634
K06634
*** None ***
Sequence
        1206 bases(100 bases per row)
ATGTCGTACCTCTCGACGTCGACGCATTTCAACAACTGGGTCTTCTCGGCGGAGGAGCTGGCGCGTGTGCGTCGTCTGCAGCATGTGAAGACGAAGCGCG
CGCTGCGTCTAGAGCGCGGGGAAACGCAGAAGGTTGAGGCGGCGGCCGCCAGTAGCCGCAAAGCGCGGTCTTTTTCGGCTCTAATACCGCGCTCGTCCAC
TGCAGTGCGCGACGCCTTCGACTGGAACGACGAGGTGAACATGGATCTGAGCACAGAGGAGGAGGCGGAGGAGAAGGCCAATCTGCAACTGACGCCGCTG
TTGGAGTTCCTGAATCCGGAACAGGAGGCGCTGCTCCGAGCTTTCTACGAGGAGAAGATCCAGGAGAGCTGCAGCGCCCAGTTCCTGCGCACTTCAGACA
AGGTCAAGTGCTGCGCCATGCTGTTATTCAAGAGGTTCTATCTAAGCAACAGTGTGATGGAGTTCCACCCCAAGTTTCTCGTCCCTACGGCCATCTACGT
GGCGGGAAAGGTCGAGGAGCAGTACATGTCCGTGGACACCGTTGCTGACCAGCTCCACGTGGACCACAAGTTCATCATTGGCCACGAGATGATCTTGCTT
GAGGGCGTGCGCTTCCAGCTCATCATGTATCACCCGTTCCGTGCGCTGCTGGGCTTCTTGGACGACTTCCGCGCCTTCGCCAAGCAGGTGTTGTCGAAGG
ATCTACCTGCGACCGTCCTGCAAAAGCTGCACGCCAATTCGACCGCACTGCTCAATGACATGCTGCTCACAGACCTGCCATTGCTGCACTACCCGTCGGT
TTTGGCGCTTGCAGCGCTATGGCATGTCACGGATGAGGTTGCTGCTAGCAGCGGTGAAAAGGCGTGCGGACTCACTAGTGCTGATGTACTGGACTACATG
AAACGCAGCAAGTTCTCTAAGGACCAGCCGGTCGACGAGGTAACGGGTCGATTTCAGCAGATTAAGCAGGCATTCCAAGCACTGAAAGCAGAAAAAGACA
AGGGCGGCGAGCAAGCCGTGCAGCATCGCGGCAAGCAGGTCAAACAGATATACAAGAAGCTGAAGCAGTTCCACAAGGATGACGAGAAGAAAGAAAAGAA
GAAGAAGGGGGACGGCAAAAAGAAGGACAAGAAGCGCAAAAACGGATCCAAGGATGACAAGAAGAAGCTTAAAAAGCAGAAGGCTAAAAGCGAAGACATT
AAATGA