Transcript Name :
Phyra_93244
Orientation:
(+)
Number of Exons:
3
Description :
26S protease regulatory subunit S10B
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain1.5SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.5531.3370.003
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
KO ID
K03064
K03064
Cluster Id
4105
Sequence
        1391 bases(100 bases per row)
ATGGCGTCCGTGCCGACCGAAGATGAGCGCACGCAGGTGCTCAACGCGTACAAGGCCAAGGTCATGGAGCACCGCGAGATGGAGAGCAGGTGTGTGGCTC
TCTTTGCATGCAAACATGTCTCTCTATAGCGCTCTATGTCCTTCGTTCAGTCGCTTGCGATCTTTCGCTTCATTTGCTGGAATTTCTTCTGCTATTTACT
CACGATTTACCGACATTTCCCCATGTAAAACAGGGTAAAGAACATGCGCGAGAACGTCAAGACGCTCGTGAAGGAGTTCAACAAGACGGAGGATGACCTC
AAGGCTCTGCAGGTGCAGTCTTACTCTATTAAAACGTTGTTATCTCCTTAACTGACGACGTTTTATCTCTACAGAGTGTGGGCCAAATCATTGGTGAAGT
GCTGCGGCAGCTAGACGAGGACCGTTTCATTGTCAAGGCGTCGAGCGGCCCGCGCTACGTCGTGGGATGCCGCGCCAAGGTGGAGAAGAGCAAACTCAAG
TCGGGTACGCGCGTGGCGCTGGACATGACGACGCTCACCATTATGCGCTACTTGCCGCGTGAGGTGGACCCCACAGTGTACCACATGCTGAATGAGGACG
CGGGCAACGTGTCGTTCTCGAGCATCGGTGGACTGAACGAGCAGATCCGCGAACTTCGTGAGGTCATCGAGCTGCCGCTCACCAACCCGGAGCTCTTCCT
GCGGGTTGGTATCAAGCCGCCCAAGGGTGTGCTATTGTACGGCCCGCCGGGTACGGGCAAGACGCTGCTGGCGCGTGCACTCGCGTGCAACATTAACGCC
ACCTTCTTGAAGGTCGTGGCTAGTGCTATTGTGGACAAGTACATCGGTGAAAGCGCCCGTGTGATTCGTGAGATGTTCGGGTACGCCCGAGACCACCAGC
CGTGTGTCATCTTCATGGATGAGATCGACGCTATCGGTGGAAGTCGTTACTCGGAAGGCACATCGGCGGATCGTGAAATTCAGCGTACGCTGATGGAGCT
GCTGAACCAGCTGGATGGATTCGACGCTCTAGGACAAGTGAAGATGGTCATGGCTACGAACCGACCGGATATTCTGGATCCGGCACTGCTGCGTCCTGGT
CGTCTTGACCGAAAGATCGAGATCCCGCTGCCTAACGAGGCCTCGCGCATGGATATTCTCAAAATTCACTCTGGCCCCATTACGAAGAAGGGCGAGATTG
ACTACGAGTCTATTGTCAAGCTCACAGATGGCTTCAACGGTGCCGATATGCGCAACGTGTGTACGGAGGCGGGTATGTTCGCTATCCGCGCTGATCGCGA
GTACGTTGTGGAGGAGGACTTCATGAAGGCTGCGCGGAAACTGGCTGAGACCAAGAAGCTCGAGTCCAAGATGGACTACAGCAAGGTTTAA