Transcript Name :
Phyra_72583
Orientation:
(-)
Number of Exons:
7
Description :
sialin-like protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain1.2PR00380
Kinesin, motor domain1.2PR00380
Kinesin, motor domain1.2PR00380
Kinesin, motor domain1.2PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain54.549PS50067
Major facilitator superfamily domain18.609PS50850
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain5.4SM00129
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
*** None ***
Cluster Id
422
Sequence
        5503 bases(100 bases per row)
ATGTCGTCGTCCTCGGTCTCCAGCGTGCACGACGCGCCCCCGCCCCCGCCCACTCCCACGAACGTGCAGGTGGCGGTGCGCTGCCGGCCGCTGAACAGCC
GCGAGAAAGCCTCGGGCCGCGGTGCTGTGGTGCAGTGCAAGCCCCACTCGAACGAGGTGGCCGTCGTCAAGCGTAAGACGTACACGTTCGACCGCGTCTT
CGGGCAGTATTCGACGCAAAAGGACGTCTTCTCGTCCGTGGTGCGGCCGGCGGTGGACGAGGCACTGGCCGGCTACAATTGCACCGTGTTCGCGTACGGC
CAGACGGGCACGGGCAAGACGTACACTATGCAGGGAGACCTCTCTCCAGATAGTGAGACGGCGGGCATCATCCCACGCAGCGTCCGCTGCATCTTTGACG
CCCTGGAAGCCAGCGGAGAGGAGTTCAGTGTCCGCGTGTCCTTCCTGCAGCTATACAACGAAGAACTCAAGGATTTACTAGACCCGGAGACAGACAAGAA
GCTGAGGCTCATGGAGGATGTCAAGCGAGGCGGCGTCTACTGTGTGAACCTGCTGGAAGTCACGGCCACAACGGCCAAACATGTGTACGAGCTCGTGAAT
ACAGGAGTGAAGAACCGGGTCACGTCCGAAACGCTTATGAACGAAAACTCCAGTCGCTCGCATAGCATTTTCACGATCAGGATTCACAGTAAGGAGCACA
ACGCCGCGGGTGAAGACTTGCTGCGCGTGGGACAGCTGAATCTAGTGGATCTGGCAGGCTCTGAGTGTGTGGGTCGGTCGGGAGCACGTAATGCAAGGGC
ACGCGAGGCTGGCACGATTAACCAGAGTTTGCTTACGCTGGGACGAGTTATCACGGCGCTGGTTGACAACCTCCCGCACGTTCCGTACCGTGATAGTAAA
CTTACGCGTCTGTTGCAGGAATCTCTCGGTGGGCGAGCGAAGACGACGATTATTGCTACATTGGCACCGTGCGCTGATAGCCTTGATGAAACTTTGAGTA
CACTGGAATATGCGTTCCGAGCGAAAAACATCAAGAACAAGCCTGAGCTCAACCAAAAAATGACCAAGGCGGGGCTGCTGAACGATTTTGGAAGCGAGAT
TGAGACGCTCCGTGCGGCCCTGCGAGCTGCTAGACTGAAAGACGGCGTCTACCTCCCGCTGGAACAATTTACTGATATGCAAGAACGACTTGCCGGCCAG
GGTGGGCAACTAACGGAGCTGGAGGATACGCTGAAGGCGAGGGACACCGCTTGTAAAGAGCTTGAGGAAGCTGCTGAGAAGTATGCGAGCGAGGTAGCAG
TTCTTACGCTTGCGAAACAAGAGGTGACCAGCAAGTTGACCGTCACGGAAGACGAATTAAGCTCTACGAAAGAGATGCTGGAGAAGACAACCCAGGAGCT
GCGAAATGCGCAGGCCGTGCTGAAATCTTTCCAGGACAACGAACAGGTGTTACTTGCCAACGGAGCTACCGCTGCAAAGCTATACAATGCCAGTGAAGAG
CGTGCTTCACAGCTTTTGACGAAGATCGGTACGTAAGGCTACCTTTGATTTTTTGAGTTCTTGGCACTGGTGACCCACTACCGACTAACTCGGTCATTTG
CTTTGACTAAAGAAAACTCCCACCGAGCAGATGAAGCCAACACAGCGCTGGCAACTTCGTATCGTAGTGAGTCCCAGTCCCAGATTAATGCGTTCCTGGA
GCGACTGGCGAAGCATAAGGAGAGCCAAGAGGGCATGTTTCAAGATGCGTCCAACGCTCTGCATGAGCTGCAGAATGGTCAGTCAGCCGACTTGGATGGT
TTAGTAACAAGTCTGAATGCTCTGCAGAGCCTGGTTGAGGCACGGAGAGTGCAGACTTCCGATTCACTTGCTGAAGACAACATTGTAAAGCGCGGTCAGC
GCAATGAAATGGCAGCGTCAATGAACGAACAACAGAAGGACATGCAAAAGCAGCTCGAGAAATTTGTTGAGATGTCAAAGACCCACACAACTGCTATTGT
GAAGGACCTGGCCACGTCTAAATCACGAAATATGTCGTTTCTGGAGACCGTGCAATCGACGTTAGAGGGATCTCGTGAAGAACTGAACAGCTTCCTGACT
GAGCAGAGCGATAAGTTGCTAGAGCTGCAAGTAGCAATCGACATGTCGGTTGAAAAGCAGACAAAGGAACTCGACGAAAGCAAGACGGCGCTCACAGCAG
CGCTGAAGGACAGTCATGATCAACACCAAGAGGAGCTGGATGGCATGAAAGTCCACCTCGCTCAGTACATTGAAAAGTGCATCCAAAGCCAAACACAGAA
ACTCAGCGAGCAAACATTGCTTATCGAAGAGAATGCGAAGAAACAACAGAAGCAGCTTTCGCACGTGCAGACTGTCACGGAGATAGAAGTGAAGGGCTTC
GTGCAGTCCATGGGTAGTCAATCCTCGAAGCATGAGAGCGAGACGGCTGCACTTCGCGAGCGTTTGTCTGAAATGCGAGGTCAACTCGGTGAAACCAACG
AACGACAAACAGAGTTAGCCCAGTCTCACGAACGGCTCCAAGCTATGTGGAGTGACGATACTGCTGCGCTTTGTAAGAAGCACACCGAGGGGATGTCTAA
CTTGATGGGGAAGCACACGAAGATAGACACCGAAACTTCGACTAGGAGAGAAGGGCAGATGACAAAGTTCATGTGTGATCACGAGGATCTCCGACAACTT
CTGGACGGAGGATGCAACACTCTGGAGAAGGGACTACAAAACCAAATTTTCAACACGAAGGGCAAGATTGACTCTGCCTCCGCGTTTGTCAAGGAGATTA
TTGGTGAAGTGACCGAGGCTTCCAGCCAGCAACTGCATGACATGGAGAGCTACATGAAGAAGCGAAAGGTAAGGCACAAACCTATTGTGTATTGATAAAA
TCAGGACTATTGCTGATGCGCGGACATGCTTTTTTTATGATCAGGTTAATGCACGGACGGGAGCTACACCGATGAAGAAGGATGATCGTCCATTCCCCAG
CTTTGAAGCCACCGAGGTTGACGCTGAGCAGTTGTATTCTCTCGAGAATTCGTCACGCCACGCCAATTCATCGAATACCGAGTCTATTCCTGGTCGCAAG
CGGAGGAGGCTGAGCGATGCCAGCACAAGTGCAATTGACGACGCCACGCACGGCGTCGAAGACACCACCGCACAAGCCCAGAGCGACGCTCCGGTCAGTA
TTATTGAGACCACCAGGACTGCCACTGCCGGTACTTCATCAGGCAGCAGTCAGGAATCCATGAACCTCAGGTCGGAAGCGGCTGGTGCGGGGTCGAGTGC
CACTGCAAACGCACCTGAGACTCAGACGGAGGCTAAGACCACTATACCCGTCAATGGTACCCCATCAAAGATCAAGACCAAGGCACCCGTCACTACCGGC
AACCGTACCCCATCAAAGATCAAGAAGATGGCATCATCTGCATTGCACAGGAAGAAGCCCGCCGTTGCCCACTCGCACAGGAGCATGAAGGTGCCCAGTG
CAGGCGCTCGCAAGATCACCAAGACGTCAACCCTCACCGCCCCGAAACGATACCGCGCTAAGTCGCCCCTAGGCGAGACCACGAGCTTCCGTTAGCTCAC
TCATCATCTTGTAACCTTATCCGCTCGATGCGAGCGTGTCATTTATTTTGATGTCCATGCAAAGTTGCCTCAACGCCATTTGTACGTGACGTACCGTAGG
TTGAAGTGGCCCTGTCCCGTGATTGGTAGAAAACCGTGATGAGTGTAACGGTCGCGATCCTATCCTCAGCTCATTTGACATCTGCCGCCATGAAGGACGC
GGCATGGAAGAAGGCGGACGTCGTCGCGACGGCTGACGCCTCTGTGAAGCTTCCGCAGGGCAGACGCCGCTACTTGACGGCGTTCCTGTGTCTCTGCGTT
TCTACCATCTGCTACGCCGACCGTAAGTCCGCCTGCAGTGCCTTTTGCCATTGAATCAAAGTCTGATGCGATGATACAGGGACCAACATGGGGATCGCGT
TACCGGCCTTCGTCACCAACAAGAAGGAGCAGGGTGAAGTGCTGTCCGCCTTCTTCTACGGTTACATGTGCACCCAAGTTCGTCACAGCAGATAGTCGAG
CCCAGAAACAGTTCTGATGCTAGTTGTGATGTTTCTGCTGCTGCTCTGTAAGTAGATCCCTGGAGGGTATTTTGCTGCCCGATTCGGCGCCAAGGGCGTG
CTGCTCACGGGGGTTATTGTTTGGACGATATTTGTACGTACAGTAGCCATTCGAGTGCTTGGTGCATTCTCTGATGGATTTGCTAAACAAAATCTCTCTC
GTTGTGCTATGCCAGGACATGTCGACGGTCGTGGTGGCCAAATGCCTCACATGCTTGTTCTTCACGAGAGCAGGCATGGGACTTGGAGAGGGCATTTTGT
TCCCGTGCATGCACCAAATCGCTGGTGCGTGGTACCCGGTCCAAGAGCGAAGTCGCCTGGTATCGCTGGTGGCAAGTGGCTCGGATTTGGGCACCATCTC
CGCGCTGCTTATATCGCCGGCAATCATGGCGGCTAGTGGCTGGGAGCGAATTTTTGTTGTCTTTGGAGTGCTCAGCTTCATTTGGGTCGTGGTGTACTCG
ATCATGGGAGTGAGCCGACCCGAGTTAGATCCCAAAATCACCTCGGAAGAACGAATTTTCATCGTGCGCAACCGCACCGTCGATCCAGAGACGCACCGTC
GTCAGACCTCGAGCGCGGAAATGGACACTCATGCCATGAACTGGCGTGTGCTGCTGACCTCACGCCCAGCGTGGGCGATCTACGTCGCGCACATGTGCTA
CAACTACAGTTGGTACATTCTGCTGGGCTGGATCCCTCAGTATTTCAACCAAGTCCTGAACCTTGATTTGACCAAGAAGGGCGGGTTTGCGGCTGCGCTG
CCCTACATGTGCGGCTACACCGGAACTCTACTCTTTGGCCGTCTGGGAGATCTACTGGTCACTCGAGGCTACCGTGAGCTGCACGTGCGACAGGCCATGA
ACGCGTTTTCGTTCCTCGGGTGTGCCTTTTTCCTTTTCTCGCTACGTCTTGCGAAGACGGCGCCAATGGCAGTTGCCTTGCTGTCGCTCACGCTGTTCAC
GAGTCGTGCTGCAATGGCTGGATATTGGGTGAACATGATCGATGTGGCGCCAAACCACGCTGCACACGTTATGGGCGTCTCCAACACCTTTGGAACCATC
CCGGGCATTATTGGAAACGTGGTCACGGGTGCCATTCTCCAAGCGACGGGGTCCTGGGACCTCGTGTTCGCGATCGCTGCCCTTGTCCTCGTCTTTGGTG
CTGTGTTCTTCCATTGCTACTCCTCTGACAAGTCGATCTACGCGCGTCCTACCGGTAGCAGCAGCAGCAACGGAGACGGGTACAGCAGCGCAAGCACAAT
CTCGAGCAGCTTCCCTGGCAGTCCCAACTACAGCCTGACTCTTTCATCGTCGATTCCTGAGCTTCGTGACGAGGAAGAAAGCCTTCTCGAGAATCCAATG
TGA