Transcript Name :
Phyra_72590
Orientation:
(-)
Number of Exons:
5
Description :
2OG-Fe(II) oxygenase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1335 bases(100 bases per row)
ATGTGGGGCGCTCGTTTCGCGCTTCGCCAGCCTCTCGGGGCCAGGAGCTGCTCGTCACCGCGTGTAATGACGGCGAGGAAGGTGGCGCTGCAGCAGCTGC
CGCTCGTGGACGTATCTCCGCTGGTTGCGGCTGCCAACAGCGGCGGCGAGGTGCCACCCGAGACGAAGGCGCAGATTTTGAGCGACATGCGCTCAGCATG
CATCGACACGGGCTTCTTCACGGTCCCCACAAAGGGAGTGCTGTCCAGTCGGCTCGTCCAGGCGGCATACAGTCGAGCTGACGAGTTTATCGCGTTGCCG
GACTCGGTCAAGCACAAGTATCACTGCAAGCGCTCGCCCAATGCTCGAGGCTGGACGCCCATGTTCGAGGAGCCATCGGTGCGATAGAATTGATATTGCT
ATGGCAGAAAGGATAGGGTGTTGATGGCCTGGTTTATGCTGCAGTACCAACCGGATGTGGTGTCCCACTTGGAAGGCTTCGATCTCGCCAGAGAGCTCCC
CAAGACGTACGTGAAGGAGGGATCGAGCTTGGGTCCTAATGTCTGGCCAGCTGAAGTGCCACAGTTTCGGGAGGACGTGTACACACTGTATGAGGAGACT
ACCAAGCTTGCGACGGTGCTGTTTCGGAGCTTTGCCGAGATGTTCGGCCTTCCATCGTCCACGTTCCTGGTGCGACAGTGATTTCATATACTAAAGCTGG
CGATAGACGGTAGTGACTTTCTTGATGCTGTAGCAACACGTCGATGAAGAAGCTGAAGCTTTCATGCGGCTGCTCACGTATCCAGAGATCGAGGCGCCTG
CGAAGAACTCGACGGTTGGGATCGCCTCACACACCGACTTCGAGTGTTTCACTATCATTCACCAGAACGGCGAAGGACTGCACTTGCTGAACCGCCAAGG
CGTTTGGGTCGAAGCACCTGTGTGCGATGACAGGTACCAAAAGACTTGGCTCACGAACCTGTCGTTGGACTAACTTGCCCTGTTTTTTTCTACTCCCAGA
CTCTTTATCATGGTTGGCGATATGCTCGAACACTGGACTAATGGCGCCCTAGTTGCTACAGAGGTAAGCTCCGCAGAAACGACGAGTCAATGCTTTGTTT
TGATCTACATATATCTTGTCTGCAGCATCGCGTGTGCAACTCGGAAAAGAAGCGCCAATCCATCGTGCGCTTCAACGGCGCGAACGGTGACACGGTCGTG
GAGCCACTTCCGGCCTTCGTGACACCAGAAAATCCGCCTCGCTACGCGAGAATGACGCAGCGCGAACACATTACCCACCAGATCGAACTGGCGGAGCAAC
TTCTGCAGAAAACCAAGGCCGCGGCGCATGCCTGA