Transcript Name :
Phyra_72594
Orientation:
(+)
Number of Exons:
3
Description :
ryanodineinositol 1 putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sugar/inositol transporter8.1PR00171
Sugar/inositol transporter8.1PR00171
Sugar/inositol transporter8.1PR00171
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain27.988PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        1767 bases(100 bases per row)
ATGGAGGCCCACGTCGACATCCACGAGAAGCTCCTGCCCAAGATTGCGCCCGTATCTCCGCAGCGCCAGCGCCTGCGAGTAGGTGGCGGTCGCTCCGCTG
CATCCACGAAGCCTGGCGCTGCGCCCGTCCGTCCCGAGGCGTCTCTCGTGGGCTGCGGCCGCACGGGTCAACTGCGGCTCGCGGCGTGGCTGGTGTCCAT
CTCATCCTTCATGTGGGGCTTCAGCGCCGCGGTGCTCAACGTTTGCATCATGCCGGACGCCGTGGGATCCATCCTCGTGGACATCAACCTCAGCACGGAG
GAGCAGGAGCTCGCCACGGCGCTCGTGGTCGTCGGCTGCGTGCTCTCGGCGCTTACCACAGGCGGGGTGGGTGCGCGCGTGGGCCAGAAGAAGACCATTC
TAGTCAACAACGTACTGTACATTGTCGGAAGCGCCGTCTGCGCGCTTGCCACCTCCAAGCGTGAGCTCTACGCCGGCCGGCTGCTCGTGGGGCTAGCGTC
GGGCGTCGTGACCAACACGGTGCCCATCTTGCTGACGGAGATCTCGCCCGCCGTCTCGCGCGGAGAAATCACGTCGTTGCACCAGCTCAGTTTAACCATT
GGCATGCTCGTCTCAGCCGTGCTGGGCTTCTTCCTCATCTCCAAGGTGCCTTCGGGGTGGAGATACCTCAACGGATTCATGATCATGCCTCCGCTCGTGC
AGTGTTTGAGCGCGTCGCTCGTCCCGGAGAGCCCGTGGTGGCTCATGAAGAACCGTGGACGCCATGACTGCCGCGCGACGCTGGTGTTTTTGCGCCCAAT
CAACCAGAAGGAGGCCGTTGAGACGGAAGTGCAGGAAATTGCGCGCGTGATGGAGCACCGCCAGCACGAGCCTCATGTGACGTGGTCGCACCTCCTCGCT
CACAAGAACGTTGTGGTGACCGGCACGATCCTCGTATTTTTCCAGGCCATGACGGGTATCAACACGGTGATGCTGTACTCGGCCAAGATTTTCCACTTTG
CTGGAGTGACCAACCCGTTCTTTGCCACGGCTGTTGTTGGCTTCACGAATGTGGGCGTCACCATTATATCCGTGCGCTTCGTGGACTCGTACGGCCGTCG
CCCGCTGCTGATCTTGGGCACGACATTATGATCGTCGCACTTGGAGTGCTGAGCTGGTCTCTACTTTACCTGAACGACAATCTTGAGGTCCAGGGCATGG
TAGCTGTGGTGTCGGTGCTCATGTTCGTTGGTGGCTTTGCTGTGGGTCTTGGCGCTGTAGTTTGGTACGACTTTACTCTTTCTCTTTCATACTCCACGGC
ACGATCGTTACTGATGCGGTATGCTGCGTTATGCAGGGTTATGCTCGGAGACATCACGCCAGTGCACATCCGCTCTCGGGCGTTTGCGTTTTACATGGTC
ATCAGCTACATCTGCAACATCCTGGTCGCTGTTTACACGCTGTCTGCCATCAGCTTTTTAGGCCGCGGTTCGAATCCCGAGAAGAACGGCATAGCCAAGC
TTTATTTGATCCTCTGGTATGTATGGGCTGAGCCGGTTGGGAGCGAGCGTATTCACTGACTAGGACGCTGCTTCGTGTTTGATTGTGGTGCTCAGCGGCG
TGGCTGTGGTGTGTCTGGCATACATCTACGCCTTCGTGGAGGAGACCTCCCATATCAAGACGGCACCGGCGAAGCTCGATGCTGATCAAAAGTCGCTCTT
GGACGAACAGGATCAAGAGGGCCTGGATGAGGAATACGGAATTCTACACCAGACGACTGATCTGTAG