Transcript Name :
Phyra_72580
Orientation:
(+)
Number of Exons:
4
Description :
tryptophan synthase
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.5821.3180.003
*** None ***
*** None ***
GO
*** None ***
KO ID
K01695
K01695
K01695
*** None ***
Sequence
        1018 bases(100 bases per row)
ATGAGCAGGTGCGCGGATGACAGCCAATTTGTCTTCTCACCAAGATCCCAGTATTGACTTATTGATTGCATTGCTGTTGCAGACCCACGATCGCAGAGGT
TATCGCCGAGCGCAAGGCCAACAATACGGCGGCCTTCATCACGTTCGTACCCTGCGGCTTCAAGACCAAGGCCGACACGGTGGACATCCTGCTGGGACTG
CAGCGCGGCGGCGCCAACATCATCGAAGTGGGCATTCCGTACTCGGACCCGCAGGCCGATGGCCCGACCATCCAGCGCGCTCACCAGGTGGGCGTGGACC
AGGGCATCACGCTGCACGACGTCCTGGCCACGGTGAGCGAGGCGCGTGCCAAGGGCCTCATCACACCCGTGGTGCTCATGGGCTACTACAACAACATCAT
GCAGTACGGTGAGGACAAGATCTGCCCCGACGCCCAGAAAGGTACGAGTCGGTGATATGGTGGTTCTTGGGCACTGCGAGCTTTACGGCTTACTATGTTA
TTGCGTGCTGGACGATCTGAAGCTGGCGTGGACGGATTCATTATTGTGGACCTGCCGCCTGAGGAGGCTAAGGTGCTAAGCGACGACGCGGCCAAGCACG
GTCTTTCGTACATTCCGCTGGTGTCTCCCACGACGACGGAGGAGCGCATGAAGCTCATTGACTCGGTGGCGCACGGCTTCGTGTACTGTGTGAGTCTGAC
GGGCGTCACGGGCGCTCGTACCGAGCTGCCGCCGAACCTCGATTCGTTCATGACCAAGAGTGAGTTGTTGCCTTTCGGATACAAAGCTCCAGCGCAGTGC
TAACTCTGTTGTGTATTGCTGTAGTTCGTGCGAATGTGAAGCACCCGCTGGCACTGGGATTCGGACTGTCGACACGTCAGCACTTTGTGCAGGCCAGCGC
GCTTGCGGATGGCGTTGTCATCGGCTCTAAAATTGTCAAGATCATCGAGGACGCGCCCGACACGGCCAGCCGCGCCGCCAACGTCGAGGCGTTCGCCAGG
AGCATCGTGGGCCCCTAG