Transcript Name :
Phyra_71022
Orientation:
(+)
Number of Exons:
2
Description :
kinesin heavy chain, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain7.6PR00380
Kinesin, motor domain7.6PR00380
Kinesin, motor domain7.6PR00380
Kinesin, motor domain7.6PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain55.242PS50067
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain6.7SM00129
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
KO ID
K10396
*** None ***
Sequence
        1115 bases(100 bases per row)
ATGGGATCCGCGGCGGAGACGCGCGCGGGTATCCGCGTGTGCGCTCGCTTCCGCCCGCAGAATAAGCTGGAGCAGAATCACCAGGCCGTGGAGTGCGTGC
GCCTGGAAGACGACGCCGCCGCGCACGTGCACAGCGAGGCTCGCGGCGTGTCGGACGATCACACCTTCACGTTCGACCAGGTCTTCGGCACCAAGTCAAC
GCAGCTGGACGTGTACGATGCGACAGCCAAGCCGCTAGTGGAGTCGGCTCTGCGCGGCTACAACTGCACGTGCTTCGTGTACGGCCAGACGGGGTCCGGC
AAGACCTTCTCGATGGAGGGTGTGCCGGGGGACGCCGACTACGAGGGCATAATCCCGCGCGTCATGGCCGATATCTTCGACGGGATCCAGAACATGCAGG
CGGACCTCGAGTTCCTTGTGCGCGTCTCGTACGTAGAGATCTACATGGAGAAAATCCGTGATCTTCTCAAACCTTCGTCTACAAATCTGAATGTGCGCGA
GAGTCGGGAGCGTGGCGTGTGGGTGGCCGGTGCGACAGAAGTGTGTTGCGCCTCAGTGGACGAGATGCAGTCCGTTATGCAACTGGGCGGAGCGAACCGA
GTCATTTCGTCGACAAGAATGAATAATGAGTCAAGTCGAAGTCATTCCGTGTTCATCATCACAATAGAACAGCGGAACACGGCGACGGGCTCATTGAAGA
GCGGAAAGTTGTTCTTGGTGGACTTGGCTGGGTCCGAGAAAGTCGGAAAGACTCACGCTCAAGGCCAAACCCTTAAAGAGGCGCAGCACATTAACAAGTC
GCTTAGTGCCTTGGGCAGCGTGATGAATGCGCTGACGAGTGGACACGCCAACACACACATTCCGTATCGCGACTCCAAGCTTACGCGGCTTTTGCAAGAC
TCGCTTGGAGGCAATTCGGAAACAACGCTTCTTGTTTGTGCTAGCTCTAGTAGCTACAATAGCGAGGAGACGGTCTCCACACTACGATTCGGAACCCGTG
CGAAGAGCATCAAGAACAAGCCGAAGGTAAACGAGGAGCGGACTGTGGCAGAATACAAGGTTCTTGTTGCTGAAAAGGACAGGCGTATAGCCTCTCTAGA
AGCTTTACTCCGTGA