Transcript Name :
Phyra_93247
Orientation:
(+)
Number of Exons:
4
Description :
papain-like cysteine protease C1
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Peptidase C1A, papain C-terminal1.4SM00645
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
cysteine-type peptidase activityGO:0008234IEA
proteolysisGO:0006508IEA
*** None ***
*** None ***
Sequence
        2138 bases(100 bases per row)
ATGGCGATCACCGACAAGTCCGACTTGCCGCTGTTGCAGCCACGCACCAGCACGCTCCTCAGCCCCAGCAACGGTCCTGAGACTTCAACGTCGTCGCTGT
TGCAGTCAAGCTGGGAGAACTTCCGAGCTGACCGCTTCCGACTGCGCTCCATTGGCTCAGTGCTCGGCTGGATCGTGCTGGGATGCTTCGTCAACTCGGC
GGTGCTCGCACCCAAGCAACTCGCCGACTACACGCACGACGGGGTCGCGATGCACGCCGTGCAAGACCAGCTCGATCTGATGGCGGCGTGTGCTGCCGCT
GGCACTGAAACCGGCGAGGGTGGCGTTGCGACGGTCCAAACGAACAAAGGAGCCGGTTGGTTCCTTGGCGGCAACGACCCCGAACACGTTTTGACACCGT
TGCAGGAAGTTCGCTCCTTTGACGACTTGCCCGAGAACTGGGACTGGCGGGACTACAACGGCACCGGTATCAGCCTCACCACCAGCATCATGAACCAAAT
GGTGCCCCGTGCGTGCGGGTCGTGCTGGGCTTTCGCCACAGTCAGCGCGTTGTCGGACCGTATCCGCATCGCGCGGTTCAAGAAGACCGGGCGACTCGAC
ACCGAGGTGTTACTGTCGCCTCAGGTGCTACTGGACTGTGGCATGCGATCCTTTGGTTCTTGCCACGGTGGAGACCCGCGGCATGCACACAAGTGGATCC
ACGAGAATGGTATCGTGGACTTGACGTGTAACCCATACATTGCGTCGCACCCGTCCTGGATGGGCGGCGGCGACTGTGCTGCCACACAGTGCCACACGTG
CAACCTGAAGGGTGAGTGTTTCGTGCTCGAAGACCCGGTAAAGTACCGCATCTCAGAGTACGGCACGCTCAACTTCACGACGTCCGAGGAGTTCCAACTG
CAGGCCATGAACGAGATCTACCATCGTGGCCCGATTGTTGTGAGCATGTACTCGCTATCACCTGAGTACCGTCAGTTCAAAGGAGGCTACATCTTGCGTG
ACTCGACGAAATACCCAGGCACGACCCATGTCGTGAGTCTTGTCGGGTGGGGCACCGACGCCAAGACTGGTGTCAAGTACTGGGTCGTCCGCAATTCGGA
CGGCACAAACTGGGGCGACCGCGGCTTCTTCCTCGCCGAGAGAGGCGTTAACATTTACAACATCGAGAGCCACGGAGCTTGGGCCGTTCCAATCGTGTAG
AGCCCAAAACTATAACCATGAATTTGAGCTGTTATTAATTTGAAGACTATTTTTTACAAATTCCTGGACTATATTCTCAGCACCTCAGATTTTGATCAGG
AATGTCGTCGCTGCTCCGGCCGTGGCGCTCGTCTCGTGCAGGCGCCTCCCGCCCCTTGAGCGTCTTAAGTGGCATCTCGGAGGACCTGCTTGTGAGCACC
AGCATCGGCCATCAAATCGGTGGCGACTCGCACGCTGCGCTGGTGGATAGTTTGGTCCGGACGAATGTGGTGGCTTCTGGCTCGCGACTGGAGGCGGCGT
TGAGGCGCGTGGACCGTGGGGACTTCGTGGCACCCGCGTTTCGAGCCTCGAGCGATCGCTATGCTAATCGCCCGTTGAAAATCGGCTCGGTAGCGACGAT
TTCCACCCCGCAGCAGCACGCGCAGGTGCTGGGGCTGTTGGAGAAGCACCTGCGGTCAGGGATGACTGCGGTGGACGTGGGCTGCGGGTCAGGCATCCTT
GTGGCTGCTATGGCTCACTTGGTGGGGCCTATGGGCTTTGTCACGGGCGTTGATATTGTGCCGGAGCTCGTGGAGTTCTCGAAACAGAATTTGCAGCGCA
GTTTGGGTAAAGAGGACGCGGAGAAGCAGACAGAGATCTTACTGAGTACAGGCAAGAGAGACCTCGGCCTCCCATCGCATGGTCGATATGACTGCATCCA
TGTCGGTGTTGCCGTAGAAACCAAGGCTGAAGCCGAGAGCTTTCTGGAGTACCTGAAGCCTGGAGGTGGACTCTTGATCCCACTTGGTGGGGCGGGTGCA
GAGCAGAAGCTGGTCAAGGTGAGAGTCGTAAAGAGGAGCGACGAGGAAGGGATTGCACTGAGCTCATAAATTCGTGTACGTTGTGGTTTTAGATGACCAA
GCATGCTGATGGAACTGTAGACAAGCGCGATATCATGA