Transcript Name :
Phyra_72585
Orientation:
(-)
Number of Exons:
8
Description :
Amino Acid-Polyamine-Organocation (APC) Family
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1427
Sequence
        4058 bases(100 bases per row)
ATGGATCGATTCCTGCTGGCTGCTGGCCGCGTGAAGCCTCTGTCGCGCTGCGAGATCGGTGCAGGATCCTTGAAGAAGTGCCTGACGCTGGTGGATCTCG
TAGCTTATGGCGTGGGCTGCTCTGTGGGCGCTGGCGTCTACTCGCTCGTGGGTGTCGGCGCTCAGATCGCGGGGCCGAGTATATCGCTGTCGTTCCTGAT
CAGCGGCCTCGCCTGCATTTTCACGTCGCTCACGTACTCGGAGTTCGCATCTCGCGTGCCTGTACGTTGCGTCACAGTCTCTGGATGGCGGTGGATGAGA
CTCTGATCGTTGTGTGAGTGAAGGTCACGGGCTCAGCGTACACGTTCGTGTACATTACCTTCGGCGAGCTGGCAGCGTGGCTTATTGGCTGGAATCTGAC
GCTGGGATACGGCATCTCCGCAGGTAACCATGGATCGCTGCTGTGGTTGGTGGAACGGGCGACTCATTGTTTGTGTGAATTCAGCTGGAATTGCTCGTAG
TTGGGCCTCGTATGCGCACTTGTTCCTGCAACACTTGGGCCTTAACCTCCCACGTTGGCTCGTGCAGGTGGAGTTTCTTGGCGTGTCGTGCAGCATCCTA
GCGGCATTTCTCGTGATTTGCTGCACGTTCATCCTTCTCGCTGGTGTTCACGTACGTACTCTGAGCGAAGATTTGGTTCCGGTGTGTACGCTGATTAAAG
ATCGTGCAATTCACAGGAATCTGCCAAGTTCAATGCGTTCGTGACGTTTCTGAATATCTCGGTGCTGCTCTTCGTCGTGGCGTTCGGAAGCACAGAAGTG
GATGCTGCGTACTGGGAGCCGTTTATGCCTACAGGGATACATGGCGTTATGACGGGTGCTGGTGTGGTCTTTTTCGCGTATTTGGGCTTTGACATGGTGG
CTTGTCTTGCTGAGGAGGTGCATGAGCCCCAGCGCACGCTGCCCAAAGGAATTATCGGGTCGCTAGTGATCTCGGTAACCATTTACGTGGGAGTTTCGCT
CGTCGTGACCGGAATGGCACCTGTGGATGTACTGGGGAATGAGGTACCTCTTGTAAACGCGTTCATCTTCCACGACGCCCCATGGGCTGGACGTATCGTA
TCGTTTGGCTCCATTTTCGGGCTTACTACTGCTGCGTTTACCTGTCTTTTGGGTCAACCGCGTATTTTCTACCAGATGGCCAAGGATGGTTTGCTGCCCT
CAGTCTTCGCTAAATTGCACATCAGGACCCATGTCCCCGTTGCTAGCACAATCTTCACTGGCATCCTGGTTGCCTCCATCGCGTTGGTTTTCGAGCTTGA
TTTCTTGGCCAATGTGATTTCGTGCGGAACACTGCAAGTCTTCACCTTCGTCAATGCTGGTGTCCTACTTTTGCGCATGCGTCCGAGTCTCAGTGGCGCT
GGTGTCGTCCGCCGCGTTCTGCTGTACGTGATAGCGTGTTTTGCTCTGTCACTGTCCTTCGTGTTCGATCTCTCGTGGACGGTTCAAGGCGCGTTCGGTA
TGATGGTGATTGCTTCGTTTGTGTATATCTACCGACTCGAGAAACTCAGGTGCGCAGCAGTGTCAATGCTTGTACCACAATGATGAACAGCTCTAACATG
TTTGCCTCTTCGTTTTTCAGTGATCTGACCTCGTCATTCCAGTGCCCATTGGTGCCGTTCGTCCCATGCGTGGGCATCCTGGCCAACATCTTCATGATGG
CAAGCATCCCAGGCGAAGGCTGGTACGTCTGTGTGGACTCCGAAGTGTTTTTCTTGACGCTAACGTGCATTTTTTTTAAGGATCGGTGTGCTTATCTGGC
TGAGCGTGGGGCTGGTCGTGTACTTGTGCTACGGGATCCGCCACAGTGTGCTAAACGATATTTCCTTGTTACGCCCACTACTTTAAAGTCATCGTCACAG
CATGCCACCAAACAGGCCAGAACATAGAGTATCACGCCTACAATATCATGCGGTTCGTGAGTACGGGGTCGCTCCGCGTGTTCGAGATCAACGGAAAGAA
GCAATCAAGGGGGTGAGCATGTCAGAAGTACCCGGGTTACGGTGGGCTTCCTCGGCTTCGTGCATCTGCAGCTGGTAGATAGACGAAGTGTATGACTGTA
ATGTACTACAGTAGTAATACAATATAATGCAATCGTATTATATTACTCTCTATGACCATAATATAATAATAGTATCTTATATGAAAATCCTTTACCGGTA
TTTTGTATCTATTTTGATCACTTACATGGTAGCTGAGCAACATTGAAGACGTGCTCGACACTGTGGACATTGCGTATTGCGTGCAGCGTCAATGCCCTCA
TCTATTGAATGCCTCCTACGTTTCCAACTGCCTAGACCCGATGTCGACGACGACGACCGGGTTGATAGTGGCGATGATGTCAGTCTTGACAACCTGTCAG
CCAGATCTGGCGACGACAAAATGCTGGAGCTCTATCGTCAGGCGGTGCCTCTCGTCCAGCCTCATTCGACGGCTGCAGTCAAAACGCTGGGGGCGATTGT
ACACGACCGCGAGCTAGTGAAGCGAATGTTGCAGCGCCCGCAGCCGTACGCCAAGCAGCTCGATAGACGACCACTCGCTTACGAAAGCCCTGCATCAAGA
CCTCCGCCACTTTCTGCTTTGCCGGTCTCACCTGGGAGTGGACTAGTCATCGGTAACCAAAGCAGCAGCCACCGCCACATGATGTTCATGGCTGCGTGCG
AGAAGCTCATGGTGACTTTCGATCCCCAAGTGCGGCATACTCGACGCGTGAAGCTTGCGCAGATCAAGCCATTGTTGCGCTTTCACGGCCTGGAGGTAGA
TAACGCAGCTTTTCGCCGGTGGGAGCAGCGATTGCAGCCTTCAACTGCTTCCGAGCTAGCGACAACGATAGGGCCGGCAGTCTCGGTCAGTGACTTTATT
CAAGCGTGCCAGCTCTGGTTTACCGAGACATTCGTCATCGACCACGTGCGAAACCTTTCAACCTGGCAGAAGCAGCAACGTGCGATGAAAGCCGGAAAAG
GGAAGCAAAAGAAACTCTTGCCACTGCACTATGAATCACCTGTACAAGTTAACCAGCCACCGTTTGACCAGCTCACGCATGAAAGCGAAGCTACGAGCAC
GTTTTCCTACGAAGCGTACGCTCGTCGCCCACCTCCACGATCACCCTCACTGAGAGCGTCCGCGTCAGCGCCAGCTTTAATCCACGCCAAGTATTGTTCG
CACAGTAAACCCGACCCAGCGACAATAGCAGCTGTAGCGAAACTCAAGAATGCCAAATTGCAGCAACGCCGAAAGGAAAAAGAGGCTGAAGGGTTAGCTC
GACGAGCACGACAGCAAAGTACCGAAATCGCGCGCGCGTTTACCGCAAGTGTGGCAATGATATCGCGCCATGTGCACAACGAGGAAGTGCGCGATCATCG
TGAAAATGAGCTTGATACGCAAATTGCTCGCACCGATCAAACTCGTCAGTGGAACCAACTCCACAAAGCGCACTGCCAGGCTATCGAGCAGGATACGCGT
GAGCAACGAGCACGTGAGGTGTGTGCTATGAAGGCTTTGGCTGAAGAAGAGCTGCTCCTATCGCGCGACTTCCGTGCGCTCCGCGAGGAGGTGGTGCGCC
GCAACAAACCTCTTTTCGCGCTATCGTCCTCCACGACCACTATCTTCCCTGCGCCGCCAGAAATCCTAGCTGCACGCGCCACAGCCAGCTCCTCGGCAGA
CCACAGACGTCTTGCCCGCGTGGAACGAGAACACGCCGAGCACATGCGCAGTCTGCAGCTACTGGACTATGCGTACGATCGCAAGCGTATCCTGGCCGCC
GCACTGCAGCCCCGCGCCAATTCCGCTTTGGTAGAGGTAGACGTGCCCGACGAAGAACTACCAGCAGACCGTCTTGTGCAGCTCGCAGGTGATGAGTTGT
GGCGACAGATCCAGCAGCAACTTGATGGAGACCCTGACAACATTGCGCTGTTCGTACCACCCAGCAACTCACCGCCAGCAGCTCTTCGTTACTTCGGCAC
GAGTCGACCCATTTCGCTGCCGGCATTCGCATCAGCTGTCGATCGTAACCTTCAGTAG