Transcript Name :
Phyra_72575
Orientation:
(+)
Number of Exons:
1
Description :
unnamed protein product
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2790 bases(100 bases per row)
ATGTCCGAGATGCTGGCTCTGGAGGCGGCGCCAGCGGCCTCGAGCGCGCTGGCCGTGGTGCCTCCGCCCCCGGAAGACAGCGTGCCTTCCGCACCCGAAG
CTGAGGTTTCCCCTGGTCCTAAAGGGACCGATGCCAAGACGCTGGCGGACCTGGCGCTGGACGTTTCTAACTGGACGTTGCACTCGGACCACGAGCTGCA
CGCGTTTCTAAAGCGCTACTCGGCCGGGCTGTTTGCGCGCACAAAGGCGCTGGAGGACAGCGTGCGGGACATCGCGGCGGACGCGGACTCGGCCCACGTG
CGGCTCAAAAACACGTTCAACCAGTTTCTAATGCTGTCTAACAACCAATTCATCGAGAACCGCGTGTACGACGAGGAGCAGGAGGATTTCTTCGGCGTAG
AGAGCGCTCAGATGAACGAGGAGAAGACCGAGGTGGACAAGGACAAGGGGACGGCGGAGAGTGTACCCGATGCAGCTGCCGAAGCCAAGGACGGAGGCGC
CAAGGCCGCGGCCGAGTCCATTGTGAACAAATATAGGGCGGCACTGGACATGGGCCTGGAGGCCATGAAGCTCTTCGTAATGATGGACGAGGAGGACGAT
ACAAGCGACACGTCATCGCAGTTTGACACGGTACTGGACATCTACAACGAACGCCCGCTGCCCTTTATCATCGGCACTCGAGAGTTCCTCGAAGACGAAA
CGCTCGGACTGGGCGCTGCACCTGAGGAGTTTTCGGACAGTGACAGCGACTCGAGCTACGCCTCGTCGTACAGCAGCTCGGACTCGGCATCCGAATCATC
GTCGGAGAGGGGGGGGAAACGCTCTTCGCGCTCTCGCTACCGGTCAAGCTCGGAGGAGTCGAGCGGATCTTCTGTTGCGGCGCCACCACCACCAAGAAGA
CGCGCGGATTCAGATGAGAGTGATACCAGCGGACTGTTCGGCCGCCCGCCGACGCTTGAGCCGTCTCGACGGCGTGCTGATTCGGATGAGAGTGATACGA
GTGGACTATTTGGTCGTCCGTCAGTGCCGGAAACAGCCACCCCGCTCCCGAAAGCTTCATCTTCGCGTAGTTCTCGACGCCGTCCTGTGTTTGACGAGGA
TGAAGAAAGCGACGATAGTGACTGGACCAGCGACAGCGACGCCGAGAGTCAAACTACGGCGAAACGCAAACAAAGTTCAACGAGCCGCCGCGAGCATGAA
ACACCGCCGCCTTTTGCTGCTCCTACTCCTGCAAGGAAGGACCGGTTCGTTGCCAGCTCCGATGAAGAGAGCGAGGTCGGCTTGTTCGGCTCGGCCCCCG
CAACGAAACCCCGGGCGTTCGCCACTGACGAAGAACCAAAACAGCATCCGTCACTGTCTGCTGGAAAGTCATCTACTAGCGATGACTTGTTTGGCGGAAG
TACCGGTACTTCGAAGCGTCGTAACAGTAGTAAACGCTTCACTTCACGCCGATCAGACTCGTTTGGCTCTTCGTCTTCGGAAGGAGAAGGGGCATTGTTT
AGTAGTACCAAGAAAACTACAACCCCGACGGCTCAAGCACCACCTCAAGGCTTCCGTTTACCCCCTATGGGCGAGACAACTCCCAAAGAGTCAAATACGC
TTCAATCGAAGAAGATCCTCCTTTCCAGCGACAACGACAGCGACACCGAGTCCACGATAAGTGGCCTTTTTGGACGTCCATCCGGCTCCACAAAAGACAC
GAAAAAGACGCCTGCAGGTGTGTCCGTACTGCCACCGCCGCAGCAGTCTCGTCGCCTCGATTTGTCAGACGACAGCAGTGATGACAATGACGATGGTGGA
CTTTTCGGGGCTGCACCAGCAAAAGCAGCTACACCGACTCCAAAGACTGCGGCATTGCCGCCCACTGCTACCCCTCCAGCCCGACGTCCAATGTATTCTG
ATAGTAGCGATGACGACGATGATGATGAAGACGAAGATGGGGGTCTGTTTGGTGCGAAGCCGCAATCTACTCTCTCAGCAACTGCAGCGCCCTCAGCACC
ACCTCCTCGCCCACAGCCGGTACACCGCGCACCGCAAAGCGGGCTGTTTGGTGAAGGTGACAGCGACGACAGTGATGACAGTGACGGTGGGGGTCTTTTT
GGCGCAAGCAAGCCAAGCAATGCCGCCGTTCCACCGCCGGTAGCTGCAAAACCACCTCCAGTTGTTGCATCAAGGCCATCGCCTGTAGTGACGCACGATG
TCAGCGATAGCGATAGTGATTACGACGACGGAGGTCTTTTTGGAACCTCGCAACCGCCCAAGCCTGTCGCTGTTGCGCCAGTTGCAGCCCCTGCAGCTCC
AGCCCGACCTCGCGTGCTCAGCGACTCGAGTGACTCGGACGATGGAGGTCTGTTTGGAGCACCACCCGTGCGATCGACGCCGACCCCGACGCCCGTTCCT
ATTGCAGCACCTACGCCTGCGGTGGCTACGTCGGTGCCGCCTGTCAGACCTTTGATTAATCGGCAAATATCATCGGACGATGATAGCGATGACTGGAGCG
ACGATGACGGTGACCTTTTTGGTGCAGCAACGTCGAAGCCAGCCCCTGCAAAGGCTATCACGACCCCAGCTCTAGCGCCAACTGTAGCAAGTACCCCTAC
CCCAGCACCATCGCAAACTGCAGCGCCGTCAGGTTCGCTGTTCGGGCCGCCGACGGGAACTACTGCATCCGTCGTTCACCCACCCATCCCCAGTGCTGCT
GCTCAAATGCGTGCGGCGGAGTCGGACTCGGATTCCTCCGACTCCGATTGGGATGACGACGGTGGGCTCTTCGGCCCAGCCAAGAAGTAA