Transcript Name :
Albla_Nc14011410
Orientation:
(+)
Number of Exons:
2
Description :
30S ribosomal protein S16 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-105
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K02959
Cluster Id
1869
Sequence
        369 bases(100 bases per row)
ATGGTGGTCCGTTTACGTCTAGCGCGTTGGGGGAGAAAAGATGTCCCGTTCTATCGCATTGTCGCTGCTGATGCGAGGTCACCAAGAGATGGGCGACATC
TAGAGATTGTGAGTAAAAATTGACTGTAATATTTAATACTATTCGTATTCTTCTTGTAGCTCGGCACGTTTAATCCAATCGCAGACGCAGCGGGTATCAA
AGAACTCCGAGTCAATCGCGATAGAGTACACTATTGGATGTCTGTTGGAGCACAGCCCTCTGATCGAGCGAGTTACCTTTTCGGACTCGCAAACGTCTTA
CCAATGCCACCGACTCGTCAGTATACGAAAAAGTGTATACCCAAAAAAGATCGAGAAGCTAAAAAGTAA