Transcript Name :
Plaha_PHALS_01384
Orientation:
(+)
Number of Exons:
1
Description :
myosinlike protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Myosin head, motor domain3.3PR00193
Myosin head, motor domain3.3PR00193
Myosin head, motor domain3.3PR00193
Myosin head, motor domain3.3PR00193
Myosin head, motor domain3.3PR00193
Profile scan predictionP-Valprediction_id
Calponin homology domain13.128PS50021
HmmSmart predictionP-Valprediction_id
Calponin homology domain5SM00033
Myosin head, motor domain3.9SM00242
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1358
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein bindingGO:0005515IEA
motor activityGO:0003774IEA
myosin complexGO:0016459IEA
*** None ***
Cluster Id
20
Sequence
        4077 bases(100 bases per row)
ATGGTGCGCCGCGCGGAGGAATTGCAGGAATGGATCTGTAGCGTCACAGCCTCATCAAACGATCATGGTGAACATCTCTCGGACATGCTGCGTGATGGCC
AATTATTGTGTCAATTAGCCAACAGTATTGACCCGAAAGCCAATCTCAAGGTCAATAAACTGAACACGGTTTTCCATTCCAAGGCTAATACGCGACTGTT
TCTCGAGTGGTGCAAGAAGAAAGGTCTAAAAGAAAGCGATATATTCCTGCCAGACGACTTACTGGACACTGATGCtaactttgacagcgtgctCGAAACA
CTTTCCATTTTATTTGACAGATTTGGTACGATAGGGTACTCTGGTGAGTACGAAGAAGACCCAGTGTCAGATGCAGAATCCATGACGTCTACTGGTAGCT
CACAGGAAAGTTCACCCGTCAAAAAAGCAACTAATAGTAAACTGAGTAATTTTATGAAGGGTGGTTTTCTATcgagaaagaagaaaaaaggtGGCGAAGA
CTTGCCAGGAAAAACACCACCATCATCGCCTCCGCCGATGTCACCTCAGACTGGAGGAGAAATGCTGTCGCCTGAAGGCGCACCACCATACTCAAGAAGC
GACAGTGGAGCAGCGAATGCGAATCGTTTAAACGCTTTTTTAAATCAAGTGCCAGCACCTCACGGATCGCCGTTGACGCACGCTGATCGTCCATCGGGGC
CTTCGAAATCAGCTAACACAGCAAAAATGGTGTCTGCTACAAAAACACTACCAAGTGTTCCAAAGTCATTATCGACGGGAGGTAACAAGCTTAACACCTT
CATGAATCAACAACCAGCCACTTCATCTGCTTCGGCAAAACCTCGGTCCCAAAACAAGCTTTCTGCTTTCTTAGCGACAAATACTGCAAGTCCTTCTCCA
TCGCAGCAGACAAACATTTCGTTGAAAAACGCTGGCAAGCGACCGACTGCCAATATAACGCAAAAAGTTCGCACGCCTACCACACCGGTGCCTTTCCAGC
CGCGGCATCGGATAGAGCGATCCACAGGTCGCGGAAACTACGTTCGCAAGCGTCAGACATATTGGGTTCATCCGAAACGTCGTCGTAGCAACTTTAGCTT
GGAAAAGAAGCGCAATGCGTTTATGCATGAACAACTTGAAATTAAAGAAGAACAACTCCGTCAACAGGCTGCAGGTGCTAGCAAcaagcaaaatttgatt
gTTCCAGGCGTGCAGTGCTACATTCCTGACAAGGATGAAGTGTGGCTGCTTTCAGAGATTGTTGACTATAATGATCGCCGAAAAGAGGTGACAATCACGG
CTTTTCTCGACTCTGGTGATTCTGAGCAGCGCATTGTGGATCTCAAAAACCCGGACGTCATTCGTGCGGTTGCAGGACCCACAGCTACTGAAGTGGAGTC
GCTACCGATTGCCATTCTCCACGACAACCCTGAGGGTGTAGAAGACATGCGCCTTCTTCGATACCTGAACGAGCCTTCAATCCTTTTTAATTTGAAGCAA
CGGTTCACCGCCTCAAAACCTTACACATACACGAACGAGATTGTGATCGCAGTAAATCCATACAAGTGGATTGATAACCTATATGGTGATCATTTGCACG
AGCAGTACTTAAAAAAACCTCGTGACTCACTGCCTCCTCACGTGTACTCAACGTCGACTGCTGCTTTCAAGCATATGAAGACTAATGCCATGAATCAGAG
TATCTTGGTCAGTGGTGAATCTGGTGCTGGTAAGACCGAAACAACTAAAATTGTCATGAATCACTTGGCTAGCGTGGCGGGTGGTCGCAAGGACAAGACG
ATTGCGAAAGTCATTGACGTCAACCCGCTTCTTGAGTCGTTTGGTAATGCAAAGACGACTCGAAATGACAACAGCTCGCGTTTCGGTAAGTTTACACAGC
TGCAATTTGACAGTCAAGGAAAACTAATTGGTGCCAAGTGCGAGACATATTTACTGGAGAAGTCACGTGTGGTATCTATCGCTGAAGGTGAGCGCAACTA
CCATATATTTTATCAGCTTTTGGCTGGTCTGTCCGCAAAGGATCGCAAGGAATTTGGTCTGGACCCTGACTGTCAATACCAGTATGCTGGTGCACTTTCG
GAAATGCAGATTCCAGGGCTGGATGATGCAAAGTGGTTTGCGAGCACGCAGAAGTCGCTGTCTATAATCGGACTGGACGGTGGTGCGCAGACAACGTTAT
TCAAAATTCTGGCTGGTGTTTTGCTACTGGGTGAAGTCTTGTTCGACAAAAGTGGTGAGAGTGGGTCACGCATATCAAGCGGCTCAGCACTGTCTCAAGC
TGCCAAGATGTTTGGCCTTCCAACCAAGAGTATCGAGGAAGCGCTGTGTAACCGCACTGTCATTACGCGTAATGATAGTGTCACAGTCCCTTTGTCCCCT
GTAGAAGCAGCTGAAAATCGTGATGCACTGGCTAAAACTATCTATTCAAAGATGTTTGACTGGATGGTGGGAAAAATTAATGGGGCTATAAGCACAGATG
AGCGCCGCATAAAGGGCCAAATCGGTGTGCTGGATATTTTTGGATTTGAGGATTTTGCTCATAATGGCTTCGAGCAGTTTTGCATTAACTATGCAAATGA
AAAACTGCAGCAGAAGTTTACAACGGATGTGTTTAAAACTGTTGAGGAGGAGTATATTCGCGAAGGCCTGCAGTGGGATCACATTAAGTATCAGGATAAC
CAGGGAATTGTGGAGGTCATTGAGGGCAAGATGGGAATTATTGCCCTCATGAACGACCATCTGCGTCAGCCTCGAGATACGGAGGAGGCTCTGGTGAACA
AAATTCGAACAAATCACCAGACAAAGAAGGGCGGCGAAGTGAACGAAAGTATTGACTTCCCTAAGGTGAAGCGTACGCAATTCATTATCAACCACTACGC
AGGTTCCGTTACATATGAGACGGTGGGGTTTATGGAAAAACATCGCGATACGCTTCAGAAAGACCTACTTGATTTAATCCAACTGAGCAGTTTGCCTTTG
CTTCCAGAGCTTTTCGAGGACCCCGAAGTTCCTGAGGAAAGTAATGGGCGCGGCAAAAAAGCTCCTAAGAGTCTTGGCTCACAGTTTAAGACATCGCTGG
CACAATTGATGGACAACATCAGGACGACTAATTCGCACTATGTGCGTTGCATCAAGCCTAACTCGAACAAGAGCTCGACTGAGTTTAATAAACGCATGAT
CGTAGAGCAATTGCGTTCAGCTGGCGTGATTGAAGCCATTCGAATCACGCGCTCTGGTTATCCAAGTCGTCTTACCCCCGCTGAGTTAGCAACGCGTTAT
GCTATCATGTTCCCGCCATCTATGCACAGTAAAGACGTCCGCCGCACGTGCAGTGTGTTTATGACTTCGATCGGTCGAAAATCGCCGCTAGAGTATCAGA
TGGGTAAATCATTGATTTACTTTAAAAATGGAGTAATGGAGGAGTTGGAGGCTATGAAGTCAGATTTTATGTATTACGAAGCGCGCACAATCCAGCGGAT
TGCACTTGGGTTCTTGGAGCGCCGACGTTTGCGCAACAAAATTAATGCTGCAATCGTATTGCAATCATACGCGCGAATGTCATTGGACTTTAAGGAGTAT
CATTTTCAGCGCCGGGCAATCAGGAAAATTCAGCGTGGTTGGAAAAAGTACAAAATGATTCCTGTCGAGCCTGAATACGACGACTATCGAGCTGATGAGT
TCAACGATGGTGAGGAGTGGGTACATGGTGAAGACGACTCGGATATGGGCGATGATTTCGATAATGACCCGGCTTCGATCCGTGGAGGACGCGGTAGGTC
GGTCGTGGACCGTATGGAGTCGTTCCGAGTGGCCCATTCAGGTCGACGCGGCAGCGTCAAACGATTAAATGAGTTGTCGGCCCGTGCCAAGAGCTTCATG
AAGCCAAGAAGTGGTAGTGGGAGCACTTCAAGCTCGAGTGGCATTTCGTTGGAAGATGAAAATTCGATGCTCAAGATCGAAAATCGCAATTTAAAATATG
ATCTGGAATTGATGCGTGAACAGTGCATCGAACTCCAAGCTATCATTCTTGAGATCAACAAAAGCCGCAAAAGGTAG